Incidental Mutation 'R3786:Wap'
ID272267
Institutional Source Beutler Lab
Gene Symbol Wap
Ensembl Gene ENSMUSG00000000381
Gene Namewhey acidic protein
Synonyms
MMRRC Submission 040753-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3786 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location6635482-6638637 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 6638550 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 25 (Q25*)
Ref Sequence ENSEMBL: ENSMUSP00000099974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102910]
Predicted Effect probably null
Transcript: ENSMUST00000102910
AA Change: Q25*
SMART Domains Protein: ENSMUSP00000099974
Gene: ENSMUSG00000000381
AA Change: Q25*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
internal_repeat_1 46 75 4.46e-5 PROSPERO
WAP 79 128 1.96e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127341
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141868
Meta Mutation Damage Score 0.6312 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutants are phenotypically normal and fertile. Functional differentiation of mammary epithelium is normal and dams produce milk, but pups thrive poorly on milk lacking whey acidic protein. A normal variant determines a one amino acid change inWAP protein in YBR versus other strains. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp6 T A 3: 97,159,289 L41Q probably damaging Het
Aoc1 T C 6: 48,905,655 L177P probably damaging Het
BC003331 A G 1: 150,384,531 I112T probably benign Het
Btbd7 C T 12: 102,838,152 E210K probably benign Het
C1qtnf12 G A 4: 155,965,899 R231H probably damaging Het
Cenpf T A 1: 189,658,337 E1099D probably damaging Het
Dennd3 T C 15: 73,547,577 V739A possibly damaging Het
Dmxl1 G A 18: 49,865,122 S763N probably damaging Het
Dzip3 C A 16: 48,975,543 C155F probably benign Het
Fam161b A T 12: 84,361,690 probably null Het
Fancd2 T G 6: 113,565,204 S770A probably damaging Het
Gpt2 G T 8: 85,525,573 V506L probably benign Het
Hao2 T A 3: 98,876,752 E327V probably damaging Het
Heatr1 G T 13: 12,434,460 L1946F probably damaging Het
Hnrnpl A G 7: 28,811,011 probably benign Het
Itgb1 T A 8: 128,713,358 I176N probably damaging Het
Kif13b C T 14: 64,800,400 T1505I probably benign Het
Magi2 C T 5: 20,465,909 T580M probably damaging Het
Mettl3 A T 14: 52,299,906 I102N probably benign Het
Mgat4c A G 10: 102,385,070 H71R probably damaging Het
Misp G A 10: 79,825,961 V71I probably benign Het
Muc2 A G 7: 141,697,347 Q734R probably benign Het
Muc5b C T 7: 141,865,116 T3933I possibly damaging Het
Myh13 A G 11: 67,327,188 N29S probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Neb C A 2: 52,201,915 V5046F probably damaging Het
Neurod1 T A 2: 79,454,595 N148I probably damaging Het
Nrg1 A T 8: 31,821,383 V376E probably damaging Het
Nsa2 G T 13: 97,135,534 Q60K possibly damaging Het
Ppp1r21 T A 17: 88,577,127 probably null Het
Rala T A 13: 17,882,446 E185V probably benign Het
Rhoc T C 3: 104,792,687 probably null Het
Robo3 A G 9: 37,422,225 V708A probably damaging Het
Rtcb G T 10: 85,942,594 T395K possibly damaging Het
Rttn A G 18: 89,037,894 T967A probably benign Het
Sacs C A 14: 61,183,961 Q116K probably damaging Het
Smarca4 A G 9: 21,672,059 H1062R possibly damaging Het
Spatc1l C T 10: 76,563,902 T86I probably benign Het
Thbs4 T C 13: 92,773,164 N375S probably benign Het
Tsc1 A G 2: 28,687,142 D1151G probably damaging Het
Ttll1 T C 15: 83,484,218 D413G probably benign Het
Wnt16 A G 6: 22,298,022 N296D probably benign Het
Other mutations in Wap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Wap APN 11 6636808 missense probably damaging 0.98
R0899:Wap UTSW 11 6636725 missense probably benign 0.00
R1330:Wap UTSW 11 6636818 missense unknown
R3783:Wap UTSW 11 6638550 nonsense probably null
R3785:Wap UTSW 11 6638550 nonsense probably null
R3787:Wap UTSW 11 6638550 nonsense probably null
R5022:Wap UTSW 11 6637339 splice site probably benign
R5065:Wap UTSW 11 6636840 missense probably damaging 0.96
R5664:Wap UTSW 11 6638609 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AACATTTCCACCCAGGTTCC -3'
(R):5'- TAGCCCATCTAGAGCTGTGC -3'

Sequencing Primer
(F):5'- CAGGTTCCTGGCTGTACAG -3'
(R):5'- GTGCCAGCCTCTTCCCC -3'
Posted On2015-03-25