Incidental Mutation 'R3787:Stab2'
ID272325
Institutional Source Beutler Lab
Gene Symbol Stab2
Ensembl Gene ENSMUSG00000035459
Gene Namestabilin 2
SynonymsSTAB-2, FEEL-2
MMRRC Submission 040754-MU
Accession Numbers

Genbank: NM_138673; MGI: 2178743

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3787 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location86841198-87008025 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86969277 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 279 (D279V)
Ref Sequence ENSEMBL: ENSMUSP00000048309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035288]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035288
AA Change: D279V

PolyPhen 2 Score 0.497 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000048309
Gene: ENSMUSG00000035459
AA Change: D279V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF 119 156 1.85e0 SMART
EGF 167 201 2.43e1 SMART
EGF 206 244 1.43e-1 SMART
EGF 248 284 3.82e-2 SMART
EGF 333 370 2.02e-1 SMART
FAS1 414 515 1.06e-8 SMART
FAS1 561 662 3.54e-19 SMART
EGF 746 783 6.76e-3 SMART
EGF 836 873 1.31e0 SMART
EGF 877 917 2.99e-4 SMART
EGF 921 960 3.51e-1 SMART
EGF 964 1002 1.99e0 SMART
FAS1 1038 1138 1.73e-13 SMART
FAS1 1181 1276 1.83e-12 SMART
EGF 1354 1391 6.92e0 SMART
EGF 1401 1435 1.11e1 SMART
EGF 1442 1477 3.01e0 SMART
EGF 1481 1519 1.64e-1 SMART
EGF 1523 1561 1.14e0 SMART
EGF 1565 1603 5.62e0 SMART
FAS1 1638 1734 2.23e-25 SMART
FAS1 1785 1891 6.92e-22 SMART
EGF 1966 2006 1.95e1 SMART
EGF_like 1977 2017 2.46e-1 SMART
EGF 2016 2050 1.14e0 SMART
EGF 2058 2089 1.56e1 SMART
EGF 2093 2130 1.36e1 SMART
EGF 2134 2173 2.13e0 SMART
LINK 2204 2298 2.08e-29 SMART
FAS1 2363 2455 3.19e-12 SMART
transmembrane domain 2467 2489 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162837
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 15 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to bind and endocytose ligands such as hyaluronan, low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein has been shown to cycle between the plasma membrane and lysosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit no gross abnormaities. Mice homozygous for one null allele display elevated serum hyaluronic acid levels and decreased metastasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G T 5: 139,455,442 P35Q probably damaging Het
Aoc1 T C 6: 48,905,655 L177P probably damaging Het
Aprt T C 8: 122,575,529 D65G probably benign Het
Auh C A 13: 52,929,457 R62L possibly damaging Het
Bmp4 C T 14: 46,385,714 probably null Het
Bptf C A 11: 107,073,827 D1514Y probably damaging Het
Carmil3 T C 14: 55,496,976 F418S probably damaging Het
Ccdc112 C T 18: 46,299,298 R72H probably benign Het
Ccdc138 T C 10: 58,538,270 Y371H probably damaging Het
Chsy3 T C 18: 59,408,998 Y403H probably damaging Het
Cul4a T C 8: 13,133,668 V352A probably damaging Het
D5Ertd577e T A 5: 95,482,897 L211Q probably damaging Het
Dennd3 T C 15: 73,547,577 V739A possibly damaging Het
Dmxl1 G A 18: 49,865,122 S763N probably damaging Het
Dmxl2 T C 9: 54,369,878 D2893G probably damaging Het
Dnah8 A G 17: 30,755,041 D2800G probably damaging Het
Dnaja2 C T 8: 85,540,386 G281R probably damaging Het
Exo1 A G 1: 175,899,469 T449A probably benign Het
Fancd2 T G 6: 113,565,204 S770A probably damaging Het
Fmo1 A T 1: 162,830,014 S519R possibly damaging Het
Fryl T C 5: 73,101,476 Y655C probably benign Het
Gpt2 G T 8: 85,525,573 V506L probably benign Het
Heatr1 G T 13: 12,434,460 L1946F probably damaging Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Magi2 C T 5: 20,465,909 T580M probably damaging Het
Mcm9 A G 10: 53,615,980 V415A possibly damaging Het
Mki67 A T 7: 135,700,283 N1007K possibly damaging Het
Mpped1 A T 15: 83,796,583 probably benign Het
Mtpap T C 18: 4,380,670 V116A probably damaging Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Neurod1 T A 2: 79,454,595 N148I probably damaging Het
Nfs1 A G 2: 156,128,583 I270T possibly damaging Het
Nr1i3 A G 1: 171,214,425 D26G probably damaging Het
Nsa2 G T 13: 97,135,534 Q60K possibly damaging Het
Olfr61 G A 7: 140,637,835 V45I probably benign Het
Olfr951 T C 9: 39,394,382 V197A probably benign Het
Pde4dip G T 3: 97,715,552 P1447Q possibly damaging Het
Plxna2 A G 1: 194,643,934 T59A probably benign Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Ppp1r12c G A 7: 4,486,584 A193V probably damaging Het
Prdm15 G T 16: 97,797,745 H904Q probably benign Het
Rala T A 13: 17,882,446 E185V probably benign Het
Reep1 T A 6: 71,795,215 D162E probably damaging Het
Rev3l T A 10: 39,846,210 L2528Q probably damaging Het
Rfc1 A T 5: 65,296,014 S264T probably benign Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Sipa1l2 C T 8: 125,423,205 A1602T probably benign Het
Sipa1l2 C A 8: 125,450,383 C1164F possibly damaging Het
Slc4a1ap T A 5: 31,528,139 L254I possibly damaging Het
Slc5a3 A G 16: 92,077,928 N291S possibly damaging Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Thbs4 T C 13: 92,773,164 N375S probably benign Het
Tro G A X: 150,655,052 T203I possibly damaging Het
Txnl4b C T 8: 109,572,777 A123V probably damaging Het
Vmn1r63 T A 7: 5,802,752 M294L probably benign Het
Vmn2r58 C T 7: 41,864,074 D382N probably benign Het
Wap G A 11: 6,638,550 Q25* probably null Het
Other mutations in Stab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Stab2 APN 10 86869206 unclassified probably null
IGL00809:Stab2 APN 10 86848174 splice site probably benign
IGL00911:Stab2 APN 10 86969753 missense probably damaging 1.00
IGL01347:Stab2 APN 10 86901703 splice site probably null
IGL01411:Stab2 APN 10 86980008 splice site probably benign
IGL01503:Stab2 APN 10 86940613 splice site probably benign
IGL01599:Stab2 APN 10 86922895 missense probably damaging 1.00
IGL01635:Stab2 APN 10 86981128 missense probably benign 0.04
IGL01640:Stab2 APN 10 86954171 missense probably benign 0.09
IGL01671:Stab2 APN 10 86969277 missense possibly damaging 0.80
IGL02023:Stab2 APN 10 86871831 missense possibly damaging 0.67
IGL02075:Stab2 APN 10 86967650 missense possibly damaging 0.71
IGL02174:Stab2 APN 10 86859742 unclassified probably null
IGL02600:Stab2 APN 10 86954259 missense probably damaging 1.00
IGL02666:Stab2 APN 10 86850902 missense possibly damaging 0.67
IGL02668:Stab2 APN 10 86846163 splice site probably benign
IGL02709:Stab2 APN 10 86846165 splice site probably benign
IGL02728:Stab2 APN 10 86856556 missense possibly damaging 0.95
IGL02803:Stab2 APN 10 86950269 splice site probably benign
IGL02938:Stab2 APN 10 86871921 missense possibly damaging 0.77
IGL03033:Stab2 APN 10 86996803 critical splice donor site probably null
IGL03238:Stab2 APN 10 86855121 missense probably damaging 1.00
IGL03402:Stab2 APN 10 86969301 missense probably benign 0.03
3-1:Stab2 UTSW 10 86869177 missense probably damaging 0.96
F6893:Stab2 UTSW 10 86855171 missense probably damaging 1.00
K7371:Stab2 UTSW 10 86943289 critical splice donor site probably null
PIT4142001:Stab2 UTSW 10 86867175 missense possibly damaging 0.94
PIT4362001:Stab2 UTSW 10 86861435 nonsense probably null
R0015:Stab2 UTSW 10 86843617 missense probably benign
R0254:Stab2 UTSW 10 86897960 missense probably benign
R0310:Stab2 UTSW 10 86967613 splice site probably benign
R0333:Stab2 UTSW 10 86841627 missense probably benign
R0391:Stab2 UTSW 10 86947144 missense probably benign 0.27
R0400:Stab2 UTSW 10 86872610 missense probably damaging 1.00
R0433:Stab2 UTSW 10 86843491 splice site probably benign
R0440:Stab2 UTSW 10 86949928 missense probably benign 0.23
R0743:Stab2 UTSW 10 86887895 missense probably damaging 1.00
R0847:Stab2 UTSW 10 86969871 missense probably benign 0.00
R0883:Stab2 UTSW 10 86924450 splice site probably benign
R1078:Stab2 UTSW 10 86907133 splice site probably null
R1118:Stab2 UTSW 10 86885718 unclassified probably null
R1119:Stab2 UTSW 10 86859755 missense possibly damaging 0.51
R1179:Stab2 UTSW 10 86950301 missense probably damaging 0.98
R1440:Stab2 UTSW 10 86861367 unclassified probably null
R1550:Stab2 UTSW 10 86878926 missense probably benign 0.01
R1616:Stab2 UTSW 10 86885718 unclassified probably null
R1728:Stab2 UTSW 10 86938039 missense probably benign 0.41
R1768:Stab2 UTSW 10 87003008 missense probably damaging 1.00
R1772:Stab2 UTSW 10 86954234 missense probably benign 0.06
R1776:Stab2 UTSW 10 86957816 missense possibly damaging 0.92
R1784:Stab2 UTSW 10 86938039 missense probably benign 0.41
R1892:Stab2 UTSW 10 86938049 missense probably damaging 0.99
R1957:Stab2 UTSW 10 86861470 missense probably benign 0.13
R1972:Stab2 UTSW 10 86960316 missense probably damaging 0.99
R1975:Stab2 UTSW 10 86896496 critical splice donor site probably null
R1976:Stab2 UTSW 10 86896496 critical splice donor site probably null
R1996:Stab2 UTSW 10 87003031 missense probably damaging 1.00
R2085:Stab2 UTSW 10 86954159 missense probably damaging 1.00
R2149:Stab2 UTSW 10 86865040 nonsense probably null
R2169:Stab2 UTSW 10 86887862 missense probably damaging 1.00
R2201:Stab2 UTSW 10 86940639 missense probably benign 0.22
R2296:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2297:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2298:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2326:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2434:Stab2 UTSW 10 86969319 missense possibly damaging 0.78
R2519:Stab2 UTSW 10 86934840 splice site probably benign
R2696:Stab2 UTSW 10 86861499 missense probably benign 0.45
R2883:Stab2 UTSW 10 86967686 missense possibly damaging 0.92
R2923:Stab2 UTSW 10 86861461 missense probably damaging 1.00
R3711:Stab2 UTSW 10 86866708 missense probably damaging 1.00
R3834:Stab2 UTSW 10 86949912 missense possibly damaging 0.87
R3970:Stab2 UTSW 10 86878886 missense probably damaging 0.97
R3979:Stab2 UTSW 10 86863456 missense possibly damaging 0.56
R4003:Stab2 UTSW 10 86858124 missense probably damaging 1.00
R4088:Stab2 UTSW 10 86922185 missense probably damaging 1.00
R4151:Stab2 UTSW 10 87002983 missense probably benign 0.12
R4190:Stab2 UTSW 10 86878944 missense probably damaging 0.98
R4556:Stab2 UTSW 10 86967679 missense possibly damaging 0.95
R4773:Stab2 UTSW 10 86907371 nonsense probably null
R4825:Stab2 UTSW 10 86947147 missense probably benign 0.08
R4865:Stab2 UTSW 10 86843500 unclassified probably null
R4871:Stab2 UTSW 10 86942235 missense probably damaging 0.99
R4943:Stab2 UTSW 10 86954162 missense probably damaging 0.99
R4981:Stab2 UTSW 10 86960223 missense probably benign
R4994:Stab2 UTSW 10 86949907 missense probably benign
R4999:Stab2 UTSW 10 86937909 missense probably damaging 0.97
R5061:Stab2 UTSW 10 86907385 missense probably damaging 1.00
R5072:Stab2 UTSW 10 86863558 missense probably benign 0.23
R5073:Stab2 UTSW 10 86863558 missense probably benign 0.23
R5074:Stab2 UTSW 10 86863558 missense probably benign 0.23
R5134:Stab2 UTSW 10 86871810 unclassified probably null
R5213:Stab2 UTSW 10 86907197 missense probably damaging 0.99
R5508:Stab2 UTSW 10 86960279 missense probably benign 0.01
R5530:Stab2 UTSW 10 86947162 missense probably benign 0.04
R5540:Stab2 UTSW 10 86848125 missense probably benign 0.30
R5839:Stab2 UTSW 10 86872691 missense probably damaging 0.97
R5949:Stab2 UTSW 10 86969849 missense possibly damaging 0.87
R6015:Stab2 UTSW 10 86938042 missense probably damaging 0.99
R6019:Stab2 UTSW 10 87003022 missense probably benign 0.00
R6116:Stab2 UTSW 10 86907190 missense probably damaging 1.00
R6131:Stab2 UTSW 10 86883778 unclassified probably null
R6209:Stab2 UTSW 10 86923003 missense possibly damaging 0.94
R6243:Stab2 UTSW 10 86907161 missense probably damaging 1.00
R6433:Stab2 UTSW 10 86901567 splice site probably null
R6787:Stab2 UTSW 10 86919084 missense probably benign 0.07
R6841:Stab2 UTSW 10 86942190 missense probably damaging 1.00
R6873:Stab2 UTSW 10 86861366 critical splice donor site probably null
R7025:Stab2 UTSW 10 86850837 missense probably damaging 1.00
R7043:Stab2 UTSW 10 86870246 missense probably damaging 0.99
R7047:Stab2 UTSW 10 86858152 missense probably damaging 1.00
R7107:Stab2 UTSW 10 86905592 missense possibly damaging 0.96
R7214:Stab2 UTSW 10 86899841 missense probably damaging 0.99
R7291:Stab2 UTSW 10 86946220 missense probably damaging 0.96
R7336:Stab2 UTSW 10 86969185 nonsense probably null
X0023:Stab2 UTSW 10 86922198 critical splice acceptor site probably null
X0025:Stab2 UTSW 10 86887816 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCCAAACTGAGCATGGGAG -3'
(R):5'- GCCTGTGATGCATGTGAGTC -3'

Sequencing Primer
(F):5'- CTGAGCATGGGAGTCAGGAAC -3'
(R):5'- CATGTGAGTCATAGTTCTCTGGC -3'
Posted On2015-03-25