Mutagenetix > Incidental Mutation

Incidental Mutation 'R3788:Kirrel1'

272363

Institutional Source

Beutler Lab

Gene Symbol

Kirrel1

Ensembl Gene

ENSMUSG00000041734

Gene Name

kirre like nephrin family adhesion molecule 1

Synonyms

6720469N11Rik, Neph1, Kirrel1, Kirrel

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3788 (G1)

Quality Score

164

Status

Validated

Chromosome

Chromosomal Location

86985900-87082054 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 86996458 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 380 (M380I)

Ref Sequence

ENSEMBL: ENSMUSP00000125525 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041732] [ENSMUST00000107618] [ENSMUST00000159976]

AlphaFold

Q80W68

Predicted Effect

probably null
Transcript: ENSMUST00000041732
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000043756
Gene: ENSMUSG00000041734
AA Change: M380I

Domain	Start	End	E-Value	Type
IG	59	149	3.62e-10	SMART
IG_like	160	252	1.27e1	SMART
IG_like	261	337	1.89e1	SMART
IGc2	352	410	3.28e-8	SMART
IG_like	430	522	5.71e0	SMART
transmembrane domain	529	551	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000107618
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000103243
Gene: ENSMUSG00000041734
AA Change: M380I

Domain	Start	End	E-Value	Type
IG	59	149	3.62e-10	SMART
IG_like	160	252	1.27e1	SMART
IG_like	261	337	1.89e1	SMART
IGc2	352	410	3.28e-8	SMART
IG_like	430	522	5.71e0	SMART
transmembrane domain	529	551	N/A	INTRINSIC
low complexity region	694	712	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000159976
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000125525
Gene: ENSMUSG00000041734
AA Change: M380I

Domain	Start	End	E-Value	Type
IG	59	149	3.62e-10	SMART
IG_like	160	252	1.27e1	SMART
IG_like	261	337	1.89e1	SMART
IGc2	352	410	3.28e-8	SMART
IG_like	430	522	5.71e0	SMART
transmembrane domain	529	551	N/A	INTRINSIC
low complexity region	694	712	N/A	INTRINSIC

Meta Mutation Damage Score

0.0922

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NEPH1 is a member of the nephrin-like protein family, which includes NEPH2 (MIM 607761) and NEPH3 (MIM 607762). The cytoplasmic domains of these proteins interact with the C terminus of podocin (NPHS2; MIM 604766), and the genes are expressed in kidney podocytes, cells involved in ensuring size- and charge-selective ultrafiltration (Sellin et al., 2003 [PubMed 12424224]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap insertion exhibit postnatal lethality and are small and sickly. Glomerular and tubular defects in the kidney result in severe proteinuria. [provided by MGI curators]

Allele List at MGI

All alleles(121) : Targeted, other(2) Gene trapped(119)

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	T	A	3: 121,846,561 (GRCm39)	V26E	possibly damaging	Het
Abhd16a	A	G	17: 35,320,563 (GRCm39)	N411S	probably damaging	Het
Akap13	G	A	7: 75,351,901 (GRCm39)		probably null	Het
Aph1b	T	C	9: 66,701,348 (GRCm39)		probably benign	Het
Aspm	C	T	1: 139,390,941 (GRCm39)	T742I	probably damaging	Het
Bclaf3	A	G	X: 158,349,492 (GRCm39)	H619R	probably benign	Het
Bltp2	T	A	11: 78,179,123 (GRCm39)		probably null	Het
Cemip	A	T	7: 83,593,106 (GRCm39)	L1199H	probably damaging	Het
Chd2	G	A	7: 73,096,878 (GRCm39)		probably benign	Het
Clnk	A	G	5: 38,872,341 (GRCm39)	Y310H	probably damaging	Het
Crmp1	A	G	5: 37,441,484 (GRCm39)	D522G	probably damaging	Het
Cyth3	A	G	5: 143,622,298 (GRCm39)		probably benign	Het
Dcbld1	T	A	10: 52,195,754 (GRCm39)	Y392N	probably damaging	Het
Flnc	T	C	6: 29,454,056 (GRCm39)	F1820L	probably damaging	Het
Galnt18	G	A	7: 111,119,322 (GRCm39)	R385*	probably null	Het
Gpatch3	C	A	4: 133,302,479 (GRCm39)	R137S	possibly damaging	Het
Gpc6	C	T	14: 117,861,878 (GRCm39)	P265S	probably damaging	Het
Harbi1	T	A	2: 91,550,952 (GRCm39)	D308E	probably benign	Het
Hdhd2	G	A	18: 77,042,883 (GRCm39)		probably null	Het
Hk1	T	C	10: 62,111,467 (GRCm39)	K737E	possibly damaging	Het
Hnrnpr	G	A	4: 136,063,624 (GRCm39)	V345M	probably damaging	Het
Ift56	T	A	6: 38,380,459 (GRCm39)		probably null	Het
Kalrn	T	C	16: 34,040,610 (GRCm39)	H944R	probably damaging	Het
Kdm2a	A	T	19: 4,401,833 (GRCm39)	C207S	probably damaging	Het
Krt75	C	T	15: 101,481,956 (GRCm39)	G104D	possibly damaging	Het
Lnpk	A	T	2: 74,352,607 (GRCm39)	S358R	probably benign	Het
Map2	A	G	1: 66,456,022 (GRCm39)	T1512A	probably damaging	Het
Marchf10	T	A	11: 105,287,905 (GRCm39)	L132F	probably damaging	Het
Mfrp	G	A	9: 44,016,754 (GRCm39)	W65*	probably null	Het
Mgat5	A	G	1: 127,294,180 (GRCm39)	D174G	probably benign	Het
Miga2	T	A	2: 30,261,237 (GRCm39)	Y177*	probably null	Het
Mroh3	T	C	1: 136,113,213 (GRCm39)	D747G	probably damaging	Het
Muc5b	A	G	7: 141,417,571 (GRCm39)	T3506A	possibly damaging	Het
Myo7b	G	T	18: 32,107,165 (GRCm39)	P1277T	possibly damaging	Het
Naaa	C	T	5: 92,420,413 (GRCm39)		probably null	Het
Ndufs2	T	C	1: 171,062,889 (GRCm39)	D410G	possibly damaging	Het
Or51a25	A	G	7: 102,372,694 (GRCm39)		probably null	Het
Or5p78	T	A	7: 108,212,280 (GRCm39)	Y255*	probably null	Het
Or7e177	A	G	9: 20,211,666 (GRCm39)	I58V	probably benign	Het
Or8g35	A	G	9: 39,381,365 (GRCm39)	I219T	probably benign	Het
Osbp	A	T	19: 11,956,285 (GRCm39)	Y409F	probably benign	Het
Plxnb1	T	A	9: 108,938,355 (GRCm39)	V1303D	possibly damaging	Het
Prkcg	G	A	7: 3,362,263 (GRCm39)	D246N	probably damaging	Het
Ranbp17	GCCTGGATACTGACC	GCC	11: 33,169,203 (GRCm39)		probably benign	Het
Sbf1	G	A	15: 89,183,731 (GRCm39)	R1261*	probably null	Het
Scn4a	T	C	11: 106,235,100 (GRCm39)	N341S	probably damaging	Het
Sec61a2	C	A	2: 5,884,436 (GRCm39)		probably null	Het
Sgcd	T	A	11: 47,246,032 (GRCm39)	K57*	probably null	Het
Sinhcaf	A	G	6: 148,827,617 (GRCm39)	S134P	possibly damaging	Het
Slc12a5	T	C	2: 164,835,695 (GRCm39)	L861P	probably damaging	Het
Slc6a16	A	G	7: 44,909,386 (GRCm39)	D184G	probably benign	Het
Snx7	A	G	3: 117,632,639 (GRCm39)		probably benign	Het
Sptbn2	A	G	19: 4,795,950 (GRCm39)	I1710V	probably damaging	Het
Sytl2	A	T	7: 90,025,289 (GRCm39)	I426F	probably benign	Het
Tdp1	A	G	12: 99,858,011 (GRCm39)		probably benign	Het
Tmem232	C	A	17: 65,689,628 (GRCm39)	D496Y	possibly damaging	Het
Tomm20l	C	T	12: 71,158,516 (GRCm39)	A58V	possibly damaging	Het
Ttn	T	C	2: 76,775,618 (GRCm39)	E1854G	unknown	Het
Ttn	A	G	2: 76,804,552 (GRCm39)	V240A	probably benign	Het
Vmn2r98	A	T	17: 19,300,887 (GRCm39)	T630S	probably benign	Het
Xrcc1	G	C	7: 24,266,333 (GRCm39)	A220P	probably benign	Het

Other mutations in Kirrel1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01310:Kirrel1	APN	3	86,997,182 (GRCm39)	missense	probably benign	0.22
IGL01865:Kirrel1	APN	3	86,993,731 (GRCm39)	missense	probably damaging	1.00
IGL01875:Kirrel1	APN	3	87,003,037 (GRCm39)	missense	probably damaging	1.00
IGL02337:Kirrel1	APN	3	86,996,519 (GRCm39)	missense	possibly damaging	0.64
IGL02724:Kirrel1	APN	3	86,997,780 (GRCm39)	nonsense	probably null
IGL02825:Kirrel1	APN	3	86,996,595 (GRCm39)	splice site	probably benign
IGL02826:Kirrel1	APN	3	86,995,792 (GRCm39)	missense	probably damaging	1.00
IGL03102:Kirrel1	APN	3	86,990,807 (GRCm39)	missense	probably damaging	0.98
D4043:Kirrel1	UTSW	3	86,990,510 (GRCm39)	missense	probably benign	0.02
R0360:Kirrel1	UTSW	3	86,997,106 (GRCm39)	missense	probably damaging	1.00
R0364:Kirrel1	UTSW	3	86,997,106 (GRCm39)	missense	probably damaging	1.00
R0421:Kirrel1	UTSW	3	86,990,914 (GRCm39)	missense	probably damaging	0.99
R0503:Kirrel1	UTSW	3	87,005,109 (GRCm39)	missense	probably benign	0.20
R1112:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1116:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1144:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1147:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1147:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1190:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1226:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1501:Kirrel1	UTSW	3	86,997,779 (GRCm39)	missense	probably benign	0.02
R1538:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1546:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1628:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1630:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1631:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1664:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1671:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1695:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1769:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1807:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1808:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1840:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1876:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1995:Kirrel1	UTSW	3	87,003,093 (GRCm39)	missense	possibly damaging	0.88
R2014:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2086:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2108:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2354:Kirrel1	UTSW	3	86,995,792 (GRCm39)	missense	probably damaging	0.98
R2407:Kirrel1	UTSW	3	86,992,150 (GRCm39)	missense	probably benign	0.03
R2904:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2905:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2958:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2959:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2960:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2961:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3026:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3028:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3034:Kirrel1	UTSW	3	86,990,746 (GRCm39)	missense	possibly damaging	0.56
R3149:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3195:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3196:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3499:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3699:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3720:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3721:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3793:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3876:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3877:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3901:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3910:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3911:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3912:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3913:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3930:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3931:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4022:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4067:Kirrel1	UTSW	3	86,995,774 (GRCm39)	nonsense	probably null
R4077:Kirrel1	UTSW	3	86,992,387 (GRCm39)	critical splice donor site	probably null
R4198:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4328:Kirrel1	UTSW	3	86,992,081 (GRCm39)	intron	probably benign
R4355:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4363:Kirrel1	UTSW	3	86,997,792 (GRCm39)	nonsense	probably null
R4378:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4386:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4460:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4468:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4469:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4650:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4652:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4734:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4748:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4749:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R5304:Kirrel1	UTSW	3	86,996,902 (GRCm39)	missense	probably benign	0.02
R5534:Kirrel1	UTSW	3	86,997,825 (GRCm39)	missense	probably damaging	1.00
R5604:Kirrel1	UTSW	3	86,996,462 (GRCm39)	missense	possibly damaging	0.69
R7199:Kirrel1	UTSW	3	86,990,695 (GRCm39)	missense	probably benign	0.02
R7221:Kirrel1	UTSW	3	86,993,704 (GRCm39)	nonsense	probably null
R7284:Kirrel1	UTSW	3	86,990,694 (GRCm39)	missense	probably benign	0.02
R7332:Kirrel1	UTSW	3	86,995,705 (GRCm39)	missense	probably benign	0.14
R7369:Kirrel1	UTSW	3	87,048,391 (GRCm39)	missense	probably benign	0.20
R7371:Kirrel1	UTSW	3	86,995,729 (GRCm39)	missense	probably benign	0.44
R7508:Kirrel1	UTSW	3	86,990,746 (GRCm39)	missense	possibly damaging	0.56
R7566:Kirrel1	UTSW	3	86,995,791 (GRCm39)	missense	probably damaging	1.00
R7567:Kirrel1	UTSW	3	87,002,988 (GRCm39)	missense	probably damaging	0.99
R7621:Kirrel1	UTSW	3	86,995,528 (GRCm39)	missense	possibly damaging	0.70
R8030:Kirrel1	UTSW	3	87,005,082 (GRCm39)	missense	probably damaging	1.00
R8141:Kirrel1	UTSW	3	86,993,735 (GRCm39)	nonsense	probably null
R8261:Kirrel1	UTSW	3	86,995,309 (GRCm39)	intron	probably benign
R8477:Kirrel1	UTSW	3	86,992,138 (GRCm39)	missense	possibly damaging	0.71
R8512:Kirrel1	UTSW	3	86,995,534 (GRCm39)	missense	probably benign	0.00
R8954:Kirrel1	UTSW	3	86,997,173 (GRCm39)	missense	probably benign	0.25
R8987:Kirrel1	UTSW	3	86,992,400 (GRCm39)	missense	probably damaging	1.00
R9058:Kirrel1	UTSW	3	86,992,442 (GRCm39)	missense	probably benign	0.18
R9146:Kirrel1	UTSW	3	87,003,015 (GRCm39)	missense	probably damaging	1.00
R9311:Kirrel1	UTSW	3	87,005,123 (GRCm39)	missense	probably benign	0.29
R9527:Kirrel1	UTSW	3	86,996,912 (GRCm39)	nonsense	probably null
R9629:Kirrel1	UTSW	3	87,003,025 (GRCm39)	nonsense	probably null
Z1177:Kirrel1	UTSW	3	86,991,182 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CCCTGAGTTCTATGCAAGTCC -3'
(R):5'- CAGAGCTGATGATTCTCAGGC -3'

Sequencing Primer
(F):5'- TATGGCTGACTGCAAGTACC -3'
(R):5'- AGCTGATGATTCTCAGGCACCTG -3'

Posted On

2015-03-25