Incidental Mutation 'R3788:Scn4a'
ID272397
Institutional Source Beutler Lab
Gene Symbol Scn4a
Ensembl Gene ENSMUSG00000001027
Gene Namesodium channel, voltage-gated, type IV, alpha
SynonymsSkM1, mH2, Nav1.4
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3788 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location106318592-106353288 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106344274 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 341 (N341S)
Ref Sequence ENSEMBL: ENSMUSP00000021056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021056]
Predicted Effect probably damaging
Transcript: ENSMUST00000021056
AA Change: N341S

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000021056
Gene: ENSMUSG00000001027
AA Change: N341S

DomainStartEndE-ValueType
Pfam:Ion_trans 130 452 1.1e-80 PFAM
low complexity region 473 491 N/A INTRINSIC
Pfam:Ion_trans 571 805 4.2e-56 PFAM
Pfam:Na_trans_assoc 810 1020 3.2e-59 PFAM
Pfam:Ion_trans 1024 1299 1.4e-64 PFAM
Pfam:Ion_trans 1346 1603 6.1e-55 PFAM
Pfam:PKD_channel 1441 1598 1.4e-6 PFAM
IQ 1720 1742 2.5e-2 SMART
low complexity region 1815 1827 N/A INTRINSIC
Meta Mutation Damage Score 0.236 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. It is expressed in skeletal muscle, and mutations in this gene have been linked to several myotonia and periodic paralysis disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous or homozygous for a knock-in allele develop myotonia, increased myofiber damage, K+-sensitive paralysis and susceptibility to delayed weakness during recovery from fatigue. Homozygotes show perinatal lethality, low survival rate, unusual hind-limb clasping and reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,288,297 probably null Het
Abca4 T A 3: 122,052,912 V26E possibly damaging Het
Abhd16a A G 17: 35,101,587 N411S probably damaging Het
Akap13 G A 7: 75,702,153 probably null Het
Aph1b T C 9: 66,794,066 probably benign Het
Aspm C T 1: 139,463,203 T742I probably damaging Het
Bclaf3 A G X: 159,566,496 H619R probably benign Het
Cemip A T 7: 83,943,898 L1199H probably damaging Het
Chd2 G A 7: 73,447,130 probably benign Het
Clnk A G 5: 38,714,998 Y310H probably damaging Het
Crmp1 A G 5: 37,284,140 D522G probably damaging Het
Cyth3 A G 5: 143,636,543 probably benign Het
Dcbld1 T A 10: 52,319,658 Y392N probably damaging Het
Fam60a A G 6: 148,926,119 S134P possibly damaging Het
Flnc T C 6: 29,454,057 F1820L probably damaging Het
Galnt18 G A 7: 111,520,115 R385* probably null Het
Gpatch3 C A 4: 133,575,168 R137S possibly damaging Het
Gpc6 C T 14: 117,624,466 P265S probably damaging Het
Harbi1 T A 2: 91,720,607 D308E probably benign Het
Hdhd2 G A 18: 76,955,187 probably null Het
Hk1 T C 10: 62,275,688 K737E possibly damaging Het
Hnrnpr G A 4: 136,336,313 V345M probably damaging Het
Kalrn T C 16: 34,220,240 H944R probably damaging Het
Kdm2a A T 19: 4,351,805 C207S probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt75 C T 15: 101,573,521 G104D possibly damaging Het
Lnpk A T 2: 74,522,263 S358R probably benign Het
Map2 A G 1: 66,416,863 T1512A probably damaging Het
March10 T A 11: 105,397,079 L132F probably damaging Het
Mfrp G A 9: 44,105,457 W65* probably null Het
Mgat5 A G 1: 127,366,443 D174G probably benign Het
Miga2 T A 2: 30,371,225 Y177* probably null Het
Mroh3 T C 1: 136,185,475 D747G probably damaging Het
Muc5b A G 7: 141,863,834 T3506A possibly damaging Het
Myo7b G T 18: 31,974,112 P1277T possibly damaging Het
Naaa C T 5: 92,272,554 probably null Het
Ndufs2 T C 1: 171,235,320 D410G possibly damaging Het
Olfr506 T A 7: 108,613,073 Y255* probably null Het
Olfr559 A G 7: 102,723,487 probably null Het
Olfr873 A G 9: 20,300,370 I58V probably benign Het
Olfr955 A G 9: 39,470,069 I219T probably benign Het
Osbp A T 19: 11,978,921 Y409F probably benign Het
Plxnb1 T A 9: 109,109,287 V1303D possibly damaging Het
Prkcg G A 7: 3,313,747 D246N probably damaging Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,219,203 probably benign Het
Sbf1 G A 15: 89,299,528 R1261* probably null Het
Sec61a2 C A 2: 5,879,625 probably null Het
Sgcd T A 11: 47,355,205 K57* probably null Het
Slc12a5 T C 2: 164,993,775 L861P probably damaging Het
Slc6a16 A G 7: 45,259,962 D184G probably benign Het
Snx7 A G 3: 117,838,990 probably benign Het
Sptbn2 A G 19: 4,745,922 I1710V probably damaging Het
Sytl2 A T 7: 90,376,081 I426F probably benign Het
Tdp1 A G 12: 99,891,752 probably benign Het
Tmem232 C A 17: 65,382,633 D496Y possibly damaging Het
Tomm20l C T 12: 71,111,742 A58V possibly damaging Het
Ttc26 T A 6: 38,403,524 probably null Het
Ttn T C 2: 76,945,274 E1854G unknown Het
Ttn A G 2: 76,974,208 V240A probably benign Het
Vmn2r98 A T 17: 19,080,625 T630S probably benign Het
Xrcc1 G C 7: 24,566,908 A220P probably benign Het
Other mutations in Scn4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Scn4a APN 11 106319919 missense probably benign
IGL00846:Scn4a APN 11 106328118 missense probably benign 0.03
IGL01063:Scn4a APN 11 106330364 missense possibly damaging 0.91
IGL01450:Scn4a APN 11 106324661 missense probably damaging 0.99
IGL01922:Scn4a APN 11 106339152 critical splice donor site probably null
IGL02589:Scn4a APN 11 106328132 missense probably benign 0.08
IGL03171:Scn4a APN 11 106345592 missense probably benign 0.01
IGL03338:Scn4a APN 11 106320845 missense probably damaging 1.00
R0013:Scn4a UTSW 11 106348405 splice site probably benign
R0013:Scn4a UTSW 11 106348405 splice site probably benign
R0025:Scn4a UTSW 11 106324560 missense probably benign 0.39
R0025:Scn4a UTSW 11 106324560 missense probably benign 0.39
R0050:Scn4a UTSW 11 106320856 missense probably damaging 1.00
R0113:Scn4a UTSW 11 106345436 missense probably benign 0.00
R0193:Scn4a UTSW 11 106320538 nonsense probably null
R0410:Scn4a UTSW 11 106323949 missense probably damaging 1.00
R0512:Scn4a UTSW 11 106345677 missense probably damaging 1.00
R0532:Scn4a UTSW 11 106330400 missense probably benign 0.45
R1112:Scn4a UTSW 11 106320466 missense probably damaging 1.00
R1279:Scn4a UTSW 11 106335682 missense probably damaging 1.00
R1564:Scn4a UTSW 11 106345541 missense probably benign
R1712:Scn4a UTSW 11 106339354 missense probably damaging 1.00
R1712:Scn4a UTSW 11 106345547 missense probably benign 0.20
R1721:Scn4a UTSW 11 106320820 missense probably benign 0.31
R1900:Scn4a UTSW 11 106327533 missense probably damaging 1.00
R2057:Scn4a UTSW 11 106335724 missense probably damaging 0.97
R2209:Scn4a UTSW 11 106339225 missense probably damaging 1.00
R3416:Scn4a UTSW 11 106330413 missense probably benign 0.00
R3853:Scn4a UTSW 11 106320106 missense possibly damaging 0.94
R3861:Scn4a UTSW 11 106326124 splice site probably benign
R3912:Scn4a UTSW 11 106320716 missense probably damaging 1.00
R3983:Scn4a UTSW 11 106347818 missense probably damaging 1.00
R4036:Scn4a UTSW 11 106322057 missense possibly damaging 0.75
R4358:Scn4a UTSW 11 106348857 intron probably null
R4556:Scn4a UTSW 11 106320446 missense probably benign 0.32
R4677:Scn4a UTSW 11 106323962 missense probably damaging 1.00
R4863:Scn4a UTSW 11 106320002 missense probably damaging 1.00
R4924:Scn4a UTSW 11 106320088 missense possibly damaging 0.83
R5081:Scn4a UTSW 11 106348727 missense probably damaging 0.99
R5298:Scn4a UTSW 11 106339386 missense probably damaging 1.00
R5407:Scn4a UTSW 11 106320889 missense probably damaging 1.00
R5634:Scn4a UTSW 11 106330004 missense probably benign
R6381:Scn4a UTSW 11 106320311 missense probably damaging 1.00
R6468:Scn4a UTSW 11 106345676 missense probably damaging 1.00
R6489:Scn4a UTSW 11 106349180 missense probably benign 0.26
R6549:Scn4a UTSW 11 106343965 missense probably damaging 1.00
R6606:Scn4a UTSW 11 106328073 missense probably benign 0.39
R7037:Scn4a UTSW 11 106320900 missense probably damaging 0.98
R7064:Scn4a UTSW 11 106322157 missense possibly damaging 0.93
R7182:Scn4a UTSW 11 106330308 missense probably benign 0.21
R7194:Scn4a UTSW 11 106324236 missense probably benign 0.32
R7531:Scn4a UTSW 11 106348697 splice site probably null
R7552:Scn4a UTSW 11 106349169 missense probably benign 0.22
R7570:Scn4a UTSW 11 106320473 missense possibly damaging 0.54
X0012:Scn4a UTSW 11 106330061 missense probably damaging 1.00
X0065:Scn4a UTSW 11 106322178 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGGTCTCCATATGTCCTCTAAGC -3'
(R):5'- AAGCTGATGTGGCTTAGCGC -3'

Sequencing Primer
(F):5'- CTCCATATGTCCTCTAAGCATGAAAG -3'
(R):5'- ATGCAGTTTATCCACTGGAGACC -3'
Posted On2015-03-25