Incidental Mutation 'R3788:Vmn2r98'
ID272405
Institutional Source Beutler Lab
Gene Symbol Vmn2r98
Ensembl Gene ENSMUSG00000096717
Gene Namevomeronasal 2, receptor 98
SynonymsEG224552
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R3788 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location19053460-19082411 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 19080625 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 630 (T630S)
Ref Sequence ENSEMBL: ENSMUSP00000131261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170424]
Predicted Effect probably benign
Transcript: ENSMUST00000170424
AA Change: T630S

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000131261
Gene: ENSMUSG00000096717
AA Change: T630S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 460 2.6e-35 PFAM
Pfam:NCD3G 509 562 7.4e-22 PFAM
Pfam:7tm_3 594 830 1.4e-52 PFAM
low complexity region 844 856 N/A INTRINSIC
Meta Mutation Damage Score 0.1256 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,288,297 probably null Het
Abca4 T A 3: 122,052,912 V26E possibly damaging Het
Abhd16a A G 17: 35,101,587 N411S probably damaging Het
Akap13 G A 7: 75,702,153 probably null Het
Aph1b T C 9: 66,794,066 probably benign Het
Aspm C T 1: 139,463,203 T742I probably damaging Het
Bclaf3 A G X: 159,566,496 H619R probably benign Het
Cemip A T 7: 83,943,898 L1199H probably damaging Het
Chd2 G A 7: 73,447,130 probably benign Het
Clnk A G 5: 38,714,998 Y310H probably damaging Het
Crmp1 A G 5: 37,284,140 D522G probably damaging Het
Cyth3 A G 5: 143,636,543 probably benign Het
Dcbld1 T A 10: 52,319,658 Y392N probably damaging Het
Fam60a A G 6: 148,926,119 S134P possibly damaging Het
Flnc T C 6: 29,454,057 F1820L probably damaging Het
Galnt18 G A 7: 111,520,115 R385* probably null Het
Gpatch3 C A 4: 133,575,168 R137S possibly damaging Het
Gpc6 C T 14: 117,624,466 P265S probably damaging Het
Harbi1 T A 2: 91,720,607 D308E probably benign Het
Hdhd2 G A 18: 76,955,187 probably null Het
Hk1 T C 10: 62,275,688 K737E possibly damaging Het
Hnrnpr G A 4: 136,336,313 V345M probably damaging Het
Kalrn T C 16: 34,220,240 H944R probably damaging Het
Kdm2a A T 19: 4,351,805 C207S probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt75 C T 15: 101,573,521 G104D possibly damaging Het
Lnpk A T 2: 74,522,263 S358R probably benign Het
Map2 A G 1: 66,416,863 T1512A probably damaging Het
March10 T A 11: 105,397,079 L132F probably damaging Het
Mfrp G A 9: 44,105,457 W65* probably null Het
Mgat5 A G 1: 127,366,443 D174G probably benign Het
Miga2 T A 2: 30,371,225 Y177* probably null Het
Mroh3 T C 1: 136,185,475 D747G probably damaging Het
Muc5b A G 7: 141,863,834 T3506A possibly damaging Het
Myo7b G T 18: 31,974,112 P1277T possibly damaging Het
Naaa C T 5: 92,272,554 probably null Het
Ndufs2 T C 1: 171,235,320 D410G possibly damaging Het
Olfr506 T A 7: 108,613,073 Y255* probably null Het
Olfr559 A G 7: 102,723,487 probably null Het
Olfr873 A G 9: 20,300,370 I58V probably benign Het
Olfr955 A G 9: 39,470,069 I219T probably benign Het
Osbp A T 19: 11,978,921 Y409F probably benign Het
Plxnb1 T A 9: 109,109,287 V1303D possibly damaging Het
Prkcg G A 7: 3,313,747 D246N probably damaging Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,219,203 probably benign Het
Sbf1 G A 15: 89,299,528 R1261* probably null Het
Scn4a T C 11: 106,344,274 N341S probably damaging Het
Sec61a2 C A 2: 5,879,625 probably null Het
Sgcd T A 11: 47,355,205 K57* probably null Het
Slc12a5 T C 2: 164,993,775 L861P probably damaging Het
Slc6a16 A G 7: 45,259,962 D184G probably benign Het
Snx7 A G 3: 117,838,990 probably benign Het
Sptbn2 A G 19: 4,745,922 I1710V probably damaging Het
Sytl2 A T 7: 90,376,081 I426F probably benign Het
Tdp1 A G 12: 99,891,752 probably benign Het
Tmem232 C A 17: 65,382,633 D496Y possibly damaging Het
Tomm20l C T 12: 71,111,742 A58V possibly damaging Het
Ttc26 T A 6: 38,403,524 probably null Het
Ttn T C 2: 76,945,274 E1854G unknown Het
Ttn A G 2: 76,974,208 V240A probably benign Het
Xrcc1 G C 7: 24,566,908 A220P probably benign Het
Other mutations in Vmn2r98
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Vmn2r98 APN 17 19065745 splice site probably benign
IGL01296:Vmn2r98 APN 17 19065185 missense probably damaging 1.00
IGL01363:Vmn2r98 APN 17 19065758 missense probably benign 0.01
IGL01618:Vmn2r98 APN 17 19065259 missense possibly damaging 0.93
IGL01746:Vmn2r98 APN 17 19066451 missense probably damaging 1.00
IGL01747:Vmn2r98 APN 17 19066440 missense probably damaging 1.00
IGL01770:Vmn2r98 APN 17 19066440 missense probably damaging 1.00
IGL01868:Vmn2r98 APN 17 19066286 missense probably benign
IGL02123:Vmn2r98 APN 17 19080679 missense probably damaging 1.00
IGL02323:Vmn2r98 APN 17 19065851 missense probably damaging 0.99
IGL02543:Vmn2r98 APN 17 19065821 missense probably benign
IGL02650:Vmn2r98 APN 17 19080961 missense probably benign 0.00
IGL02676:Vmn2r98 APN 17 19065259 missense probably benign 0.00
IGL02803:Vmn2r98 APN 17 19066013 missense probably benign
IGL02807:Vmn2r98 APN 17 19081021 missense probably damaging 1.00
IGL03307:Vmn2r98 APN 17 19065980 missense possibly damaging 0.62
IGL03396:Vmn2r98 APN 17 19069845 missense possibly damaging 0.92
PIT4131001:Vmn2r98 UTSW 17 19080961 missense probably benign 0.00
R0122:Vmn2r98 UTSW 17 19066400 missense probably benign 0.06
R0329:Vmn2r98 UTSW 17 19066347 missense probably benign 0.21
R0330:Vmn2r98 UTSW 17 19066347 missense probably benign 0.21
R0368:Vmn2r98 UTSW 17 19065827 nonsense probably null
R0545:Vmn2r98 UTSW 17 19053613 missense probably benign 0.15
R0635:Vmn2r98 UTSW 17 19080497 missense probably benign 0.00
R0689:Vmn2r98 UTSW 17 19080520 missense possibly damaging 0.83
R1035:Vmn2r98 UTSW 17 19080749 missense possibly damaging 0.90
R1243:Vmn2r98 UTSW 17 19065948 missense possibly damaging 0.52
R1421:Vmn2r98 UTSW 17 19065178 missense probably damaging 1.00
R1629:Vmn2r98 UTSW 17 19067383 missense possibly damaging 0.94
R1643:Vmn2r98 UTSW 17 19080908 missense probably damaging 1.00
R1795:Vmn2r98 UTSW 17 19066440 missense probably damaging 1.00
R1958:Vmn2r98 UTSW 17 19066418 missense possibly damaging 0.70
R1962:Vmn2r98 UTSW 17 19065333 nonsense probably null
R2165:Vmn2r98 UTSW 17 19081291 missense unknown
R2238:Vmn2r98 UTSW 17 19065951 missense probably damaging 1.00
R2252:Vmn2r98 UTSW 17 19080436 missense probably benign 0.00
R2323:Vmn2r98 UTSW 17 19065819 missense probably benign 0.18
R2887:Vmn2r98 UTSW 17 19081177 missense possibly damaging 0.83
R2909:Vmn2r98 UTSW 17 19067402 missense probably damaging 1.00
R3001:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3002:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3003:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R4570:Vmn2r98 UTSW 17 19066092 missense probably benign 0.11
R4706:Vmn2r98 UTSW 17 19069745 missense probably damaging 1.00
R4723:Vmn2r98 UTSW 17 19066340 missense probably benign 0.01
R5036:Vmn2r98 UTSW 17 19066157 missense probably benign 0.00
R5072:Vmn2r98 UTSW 17 19066044 missense probably benign 0.07
R5121:Vmn2r98 UTSW 17 19053553 missense probably benign 0.13
R5283:Vmn2r98 UTSW 17 19080719 missense probably benign 0.05
R5294:Vmn2r98 UTSW 17 19069754 nonsense probably null
R5371:Vmn2r98 UTSW 17 19069753 missense probably damaging 1.00
R5532:Vmn2r98 UTSW 17 19067383 missense possibly damaging 0.94
R5598:Vmn2r98 UTSW 17 19080899 missense probably benign 0.37
R5800:Vmn2r98 UTSW 17 19065998 missense probably benign 0.17
R6089:Vmn2r98 UTSW 17 19066074 missense probably benign 0.29
R6155:Vmn2r98 UTSW 17 19065881 missense possibly damaging 0.87
R6853:Vmn2r98 UTSW 17 19065801 missense probably benign 0.00
R6920:Vmn2r98 UTSW 17 19065248 missense probably damaging 0.98
R7012:Vmn2r98 UTSW 17 19066268 missense probably benign 0.06
R7042:Vmn2r98 UTSW 17 19080922 missense probably benign
R7068:Vmn2r98 UTSW 17 19065313 missense probably benign
Predicted Primers PCR Primer
(F):5'- GACAAGTGTGTGAAATGTCCTG -3'
(R):5'- ACCATTCTCCCTGGAAAACTG -3'

Sequencing Primer
(F):5'- CTGCTTCCAAAAATCTGTGAGC -3'
(R):5'- CTCCCTGGAAAACTGATCTTAAAGG -3'
Posted On2015-03-25