Incidental Mutation 'R3789:Map2'
ID272416
Institutional Source Beutler Lab
Gene Symbol Map2
Ensembl Gene ENSMUSG00000015222
Gene Namemicrotubule-associated protein 2
Synonymsrepro4, MAP-2, Mtap2, G1-397-34
MMRRC Submission 041604-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.506) question?
Stock #R3789 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location66175273-66442583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66416863 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1512 (T1512A)
Ref Sequence ENSEMBL: ENSMUSP00000109646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024639] [ENSMUST00000077355] [ENSMUST00000114012] [ENSMUST00000114013] [ENSMUST00000114015] [ENSMUST00000114017] [ENSMUST00000114018] [ENSMUST00000145419] [ENSMUST00000172886] [ENSMUST00000173778] [ENSMUST00000173800] [ENSMUST00000173855]
Predicted Effect probably benign
Transcript: ENSMUST00000024639
SMART Domains Protein: ENSMUSP00000024639
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077355
SMART Domains Protein: ENSMUSP00000076577
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114012
SMART Domains Protein: ENSMUSP00000109645
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 133 140 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
low complexity region 205 221 N/A INTRINSIC
low complexity region 228 250 N/A INTRINSIC
Pfam:Tubulin-binding 299 330 2.1e-18 PFAM
Pfam:Tubulin-binding 331 361 9.1e-20 PFAM
Pfam:Tubulin-binding 362 393 1.7e-17 PFAM
low complexity region 421 434 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114013
AA Change: T1512A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109646
Gene: ENSMUSG00000015222
AA Change: T1512A

DomainStartEndE-ValueType
Pfam:RII_binding_1 86 103 1.2e-5 PFAM
low complexity region 120 141 N/A INTRINSIC
Pfam:MAP2_projctn 376 1510 N/A PFAM
low complexity region 1543 1557 N/A INTRINSIC
low complexity region 1567 1583 N/A INTRINSIC
low complexity region 1590 1612 N/A INTRINSIC
Pfam:Tubulin-binding 1662 1692 1.7e-13 PFAM
Pfam:Tubulin-binding 1693 1723 5.8e-18 PFAM
Pfam:Tubulin-binding 1724 1755 5.9e-18 PFAM
low complexity region 1783 1796 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114015
SMART Domains Protein: ENSMUSP00000109648
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114017
SMART Domains Protein: ENSMUSP00000109650
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.3e-18 PFAM
Pfam:Tubulin-binding 332 362 2.3e-19 PFAM
Pfam:Tubulin-binding 363 393 9.9e-20 PFAM
Pfam:Tubulin-binding 394 425 1.9e-17 PFAM
low complexity region 453 466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114018
SMART Domains Protein: ENSMUSP00000109651
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.3e-18 PFAM
Pfam:Tubulin-binding 332 362 2.3e-19 PFAM
Pfam:Tubulin-binding 363 393 9.9e-20 PFAM
Pfam:Tubulin-binding 394 425 1.9e-17 PFAM
low complexity region 453 466 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133522
Predicted Effect probably benign
Transcript: ENSMUST00000141148
SMART Domains Protein: ENSMUSP00000117996
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
Pfam:RII_binding_1 23 40 3.2e-6 PFAM
low complexity region 70 77 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145419
SMART Domains Protein: ENSMUSP00000134538
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
Pfam:MAP2_projctn 218 608 1.7e-250 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151423
Predicted Effect probably benign
Transcript: ENSMUST00000172886
SMART Domains Protein: ENSMUSP00000133446
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
Pfam:MAP2_projctn 1 107 3.9e-54 PFAM
low complexity region 112 126 N/A INTRINSIC
low complexity region 136 152 N/A INTRINSIC
low complexity region 159 181 N/A INTRINSIC
Pfam:Tubulin-binding 230 261 1.4e-18 PFAM
Pfam:Tubulin-binding 262 292 1.4e-19 PFAM
Pfam:Tubulin-binding 293 323 6e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173778
AA Change: T126A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134651
Gene: ENSMUSG00000015222
AA Change: T126A

DomainStartEndE-ValueType
Pfam:MAP2_projctn 1 124 4.8e-84 PFAM
low complexity region 157 171 N/A INTRINSIC
low complexity region 181 197 N/A INTRINSIC
low complexity region 204 226 N/A INTRINSIC
Pfam:Tubulin-binding 275 306 1.6e-18 PFAM
Pfam:Tubulin-binding 307 337 1.6e-19 PFAM
Pfam:Tubulin-binding 338 368 7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173800
AA Change: T25A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134518
Gene: ENSMUSG00000015222
AA Change: T25A

DomainStartEndE-ValueType
Pfam:MAP2_projctn 1 23 2.2e-11 PFAM
low complexity region 55 69 N/A INTRINSIC
low complexity region 79 95 N/A INTRINSIC
low complexity region 102 124 N/A INTRINSIC
Pfam:Tubulin-binding 173 204 8.7e-19 PFAM
Pfam:Tubulin-binding 205 235 3.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173855
SMART Domains Protein: ENSMUSP00000134471
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 142 163 N/A INTRINSIC
Pfam:MAP2_projctn 458 565 1.1e-52 PFAM
Meta Mutation Damage Score 0.098 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The products of similar genes in rat and mouse are neuron-specific cytoskeletal proteins that are enriched in dentrites, implicating a role in determining and stabilizing dentritic shape during neuron development. A number of alternatively spliced variants encoding distinct isoforms have been described. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered contextual memory. Mice homozygous for another knock-out allele display decreased body weight, altered microtubule density and organization in Purkinje cell dendrites, and reduced dendritic length inhippocampal neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230104L09Rik C A 2: 148,847,958 E92* probably null Het
Abca13 T A 11: 9,510,668 I4226N probably damaging Het
Abhd16a A G 17: 35,101,587 N411S probably damaging Het
Acvrl1 C T 15: 101,137,469 T292M probably damaging Het
Adamts8 T C 9: 30,959,292 S688P probably damaging Het
Adprhl2 A T 4: 126,316,751 I312N probably damaging Het
Bclaf3 A G X: 159,566,496 H619R probably benign Het
Clca4a C A 3: 144,974,956 G20V probably damaging Het
Col12a1 C A 9: 79,639,723 V2276L possibly damaging Het
Drosha T A 15: 12,912,537 Y1080* probably null Het
Dysf G A 6: 84,186,509 probably null Het
Ebf2 T A 14: 67,239,493 probably null Het
Emc8 T C 8: 120,658,130 T195A probably benign Het
Fam60a A G 6: 148,926,119 S134P possibly damaging Het
Frs3 G A 17: 47,699,696 probably null Het
Fsip2 T C 2: 82,982,714 S640P probably damaging Het
Hdhd2 G A 18: 76,955,187 probably null Het
Hivep3 T C 4: 120,098,416 S1310P probably damaging Het
Hltf C T 3: 20,069,047 P200S probably damaging Het
Lnpk A T 2: 74,522,263 S358R probably benign Het
Lrp1 T C 10: 127,571,969 D1817G possibly damaging Het
Lrpprc T C 17: 84,771,528 I253V probably benign Het
Mcm9 G A 10: 53,616,017 R403W probably damaging Het
Mms22l A G 4: 24,517,115 D222G possibly damaging Het
Mug1 G A 6: 121,884,628 V1350I probably benign Het
Olfr663 T A 7: 104,703,949 D127E probably damaging Het
Pclo A G 5: 14,680,450 probably benign Het
Plekha7 A C 7: 116,175,734 I175R probably damaging Het
Plxnb1 T A 9: 109,109,287 V1303D possibly damaging Het
Pou2f1 G C 1: 165,894,969 P349R probably damaging Het
Prmt8 A T 6: 127,711,147 I236N probably damaging Het
Rexo2 A G 9: 48,473,062 I139T probably damaging Het
Rsbn1l A C 5: 20,896,108 S811R probably benign Het
Sec24b T C 3: 130,020,627 D345G probably benign Het
Serpina1b A G 12: 103,729,272 S337P probably damaging Het
Snx33 T C 9: 56,918,560 E539G probably benign Het
Sorcs3 A G 19: 48,398,711 T212A possibly damaging Het
Spa17 T G 9: 37,611,845 K49Q possibly damaging Het
St3gal6 C T 16: 58,484,773 E109K probably benign Het
Stat4 A G 1: 52,011,796 N5D probably benign Het
Tmem232 C T 17: 65,382,525 D532N probably benign Het
Tmem232 C A 17: 65,382,633 D496Y possibly damaging Het
Tmem81 A G 1: 132,508,071 N205S probably benign Het
Tomm20l C T 12: 71,111,742 A58V possibly damaging Het
Ttn A G 2: 76,974,208 V240A probably benign Het
Vmn2r23 A T 6: 123,741,389 N567I probably damaging Het
Other mutations in Map2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Map2 APN 1 66425331 missense probably damaging 1.00
IGL02135:Map2 APN 1 66380761 nonsense probably null
IGL02526:Map2 APN 1 66380717 missense possibly damaging 0.94
Annas UTSW 1 66433597 critical splice donor site probably null
calliope UTSW 1 66425298 missense probably damaging 1.00
ruby_throat UTSW 1 66414884 missense possibly damaging 0.67
E0370:Map2 UTSW 1 66416724 unclassified probably benign
R0067:Map2 UTSW 1 66413163 missense probably benign 0.04
R0238:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0238:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0239:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0239:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0268:Map2 UTSW 1 66380722 nonsense probably null
R0302:Map2 UTSW 1 66414828 missense probably benign 0.15
R0305:Map2 UTSW 1 66413094 missense probably benign 0.00
R0409:Map2 UTSW 1 66433580 missense probably damaging 1.00
R0561:Map2 UTSW 1 66425497 missense probably damaging 1.00
R0674:Map2 UTSW 1 66413202 missense probably damaging 1.00
R0738:Map2 UTSW 1 66425189 splice site probably benign
R0893:Map2 UTSW 1 66380768 missense probably damaging 1.00
R1305:Map2 UTSW 1 66425395 missense probably damaging 1.00
R1534:Map2 UTSW 1 66413180 missense probably benign 0.33
R1632:Map2 UTSW 1 66415086 missense possibly damaging 0.60
R1682:Map2 UTSW 1 66415622 unclassified probably null
R1774:Map2 UTSW 1 66414074 missense probably damaging 1.00
R2014:Map2 UTSW 1 66416136 missense possibly damaging 0.55
R2017:Map2 UTSW 1 66412799 missense probably damaging 1.00
R2050:Map2 UTSW 1 66414314 missense probably damaging 0.98
R2093:Map2 UTSW 1 66399440 missense probably damaging 1.00
R2214:Map2 UTSW 1 66420186 missense probably damaging 0.99
R2284:Map2 UTSW 1 66414068 missense probably damaging 1.00
R3011:Map2 UTSW 1 66414612 missense probably damaging 1.00
R3105:Map2 UTSW 1 66433597 critical splice donor site probably null
R3708:Map2 UTSW 1 66416555 unclassified probably benign
R3709:Map2 UTSW 1 66415856 nonsense probably null
R3729:Map2 UTSW 1 66412446 missense possibly damaging 0.80
R3760:Map2 UTSW 1 66438918 missense probably damaging 1.00
R3788:Map2 UTSW 1 66416863 missense probably damaging 0.99
R4003:Map2 UTSW 1 66415740 missense probably damaging 1.00
R4120:Map2 UTSW 1 66415904 missense probably damaging 1.00
R4172:Map2 UTSW 1 66413600 missense possibly damaging 0.89
R4198:Map2 UTSW 1 66425298 missense probably damaging 1.00
R4200:Map2 UTSW 1 66425298 missense probably damaging 1.00
R4205:Map2 UTSW 1 66425290 missense probably damaging 1.00
R4613:Map2 UTSW 1 66425469 missense probably damaging 1.00
R4700:Map2 UTSW 1 66410637 missense probably damaging 0.96
R4974:Map2 UTSW 1 66413505 missense probably benign 0.15
R5007:Map2 UTSW 1 66413289 missense possibly damaging 0.86
R5039:Map2 UTSW 1 66438796 missense probably damaging 1.00
R5237:Map2 UTSW 1 66439010 unclassified probably benign
R5313:Map2 UTSW 1 66425379 missense probably damaging 1.00
R5455:Map2 UTSW 1 66399391 missense probably damaging 1.00
R5490:Map2 UTSW 1 66413133 missense probably damaging 1.00
R5517:Map2 UTSW 1 66415256 missense probably benign 0.00
R5532:Map2 UTSW 1 66414620 missense probably damaging 1.00
R5583:Map2 UTSW 1 66416037 missense probably damaging 1.00
R5764:Map2 UTSW 1 66414875 missense probably damaging 0.99
R5996:Map2 UTSW 1 66414884 missense possibly damaging 0.67
R6058:Map2 UTSW 1 66415414 missense probably benign 0.05
R6199:Map2 UTSW 1 66425478 missense probably damaging 1.00
R6208:Map2 UTSW 1 66431590 missense probably damaging 1.00
R6276:Map2 UTSW 1 66399419 missense probably damaging 1.00
R6378:Map2 UTSW 1 66415329 missense probably damaging 1.00
R6424:Map2 UTSW 1 66414787 missense possibly damaging 0.67
R6743:Map2 UTSW 1 66415607 missense probably benign 0.04
R6837:Map2 UTSW 1 66414572 missense probably damaging 1.00
R6901:Map2 UTSW 1 66421773 missense possibly damaging 0.94
R6984:Map2 UTSW 1 66415236 missense possibly damaging 0.90
R6989:Map2 UTSW 1 66414906 missense probably benign 0.00
V8831:Map2 UTSW 1 66415845 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACAAAGCAACTTGCCTAACTAG -3'
(R):5'- ATGACCTCTTCTGCAGGGAG -3'

Sequencing Primer
(F):5'- CAAGTGTTTGCTTTCTTTCCTGATG -3'
(R):5'- GAAACTGTTCATGATTGCTG -3'
Posted On2015-03-25