Mutagenetix > Incidental Mutation

Incidental Mutation 'R3789:Sorcs3'

272463

Institutional Source

Beutler Lab

Gene Symbol

Sorcs3

Ensembl Gene

ENSMUSG00000063434

Gene Name

sortilin-related VPS10 domain containing receptor 3

Synonyms

6330404A12Rik

MMRRC Submission

041604-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.101) question?

Stock #

R3789 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

48194464-48793944 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 48387150 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 212 (T212A)

Ref Sequence

ENSEMBL: ENSMUSP00000077919 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078880]

AlphaFold

Q8VI51

Predicted Effect

possibly damaging
Transcript: ENSMUST00000078880
AA Change: T212A

PolyPhen 2 Score 0.459 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000077919
Gene: ENSMUSG00000063434
AA Change: T212A

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	46	63	N/A	INTRINSIC
low complexity region	69	91	N/A	INTRINSIC
VPS10	216	818	N/A	SMART
Pfam:PKD	823	901	8e-13	PFAM
transmembrane domain	1122	1141	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I receptor transmembrane protein that is a member of the vacuolar protein sorting 10 receptor family. Proteins of this family are defined by a vacuolar protein sorting 10 domain at the N-terminus. The N-terminal segment of this domain has a consensus motif for proprotein convertase processing, and the C-terminal segment of this domain is characterized by ten conserved cysteine residues. The vacuolar protein sorting 10 domain is followed by a leucine-rich segment, a transmembrane domain, and a short C-terminal cytoplasmic domain that interacts with adaptor molecules. The transcript is expressed at high levels in the brain, and candidate gene studies suggest that genetic variation in this gene is associated with Alzheimer's disease. Consistent with this observation, knockdown of the gene in cell culture results in an increase in amyloid precursor protein processing. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit absent NMDA and glutamate receptor-dependent long term depression, impaired spatial learning and memory and impaired fear memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	A	11: 9,460,668 (GRCm39)	I4226N	probably damaging	Het
Abhd16a	A	G	17: 35,320,563 (GRCm39)	N411S	probably damaging	Het
Acvrl1	C	T	15: 101,035,350 (GRCm39)	T292M	probably damaging	Het
Adamts8	T	C	9: 30,870,588 (GRCm39)	S688P	probably damaging	Het
Adprs	A	T	4: 126,210,544 (GRCm39)	I312N	probably damaging	Het
Bclaf3	A	G	X: 158,349,492 (GRCm39)	H619R	probably benign	Het
Clca4a	C	A	3: 144,680,717 (GRCm39)	G20V	probably damaging	Het
Col12a1	C	A	9: 79,547,005 (GRCm39)	V2276L	possibly damaging	Het
Cstdc2	C	A	2: 148,689,878 (GRCm39)	E92*	probably null	Het
Drosha	T	A	15: 12,912,623 (GRCm39)	Y1080*	probably null	Het
Dysf	G	A	6: 84,163,491 (GRCm39)		probably null	Het
Ebf2	T	A	14: 67,476,942 (GRCm39)		probably null	Het
Emc8	T	C	8: 121,384,869 (GRCm39)	T195A	probably benign	Het
Frs3	G	A	17: 48,010,621 (GRCm39)		probably null	Het
Fsip2	T	C	2: 82,813,058 (GRCm39)	S640P	probably damaging	Het
Hdhd2	G	A	18: 77,042,883 (GRCm39)		probably null	Het
Hivep3	T	C	4: 119,955,613 (GRCm39)	S1310P	probably damaging	Het
Hltf	C	T	3: 20,123,211 (GRCm39)	P200S	probably damaging	Het
Lnpk	A	T	2: 74,352,607 (GRCm39)	S358R	probably benign	Het
Lrp1	T	C	10: 127,407,838 (GRCm39)	D1817G	possibly damaging	Het
Lrpprc	T	C	17: 85,078,956 (GRCm39)	I253V	probably benign	Het
Map2	A	G	1: 66,456,022 (GRCm39)	T1512A	probably damaging	Het
Mcm9	G	A	10: 53,492,113 (GRCm39)	R403W	probably damaging	Het
Mms22l	A	G	4: 24,517,115 (GRCm39)	D222G	possibly damaging	Het
Mug1	G	A	6: 121,861,587 (GRCm39)	V1350I	probably benign	Het
Or56b2j	T	A	7: 104,353,156 (GRCm39)	D127E	probably damaging	Het
Pclo	A	G	5: 14,730,464 (GRCm39)		probably benign	Het
Plekha7	A	C	7: 115,774,969 (GRCm39)	I175R	probably damaging	Het
Plxnb1	T	A	9: 108,938,355 (GRCm39)	V1303D	possibly damaging	Het
Pou2f1	G	C	1: 165,722,538 (GRCm39)	P349R	probably damaging	Het
Prmt8	A	T	6: 127,688,110 (GRCm39)	I236N	probably damaging	Het
Rexo2	A	G	9: 48,384,362 (GRCm39)	I139T	probably damaging	Het
Rsbn1l	A	C	5: 21,101,106 (GRCm39)	S811R	probably benign	Het
Sec24b	T	C	3: 129,814,276 (GRCm39)	D345G	probably benign	Het
Serpina1b	A	G	12: 103,695,531 (GRCm39)	S337P	probably damaging	Het
Sinhcaf	A	G	6: 148,827,617 (GRCm39)	S134P	possibly damaging	Het
Snx33	T	C	9: 56,825,844 (GRCm39)	E539G	probably benign	Het
Spa17	T	G	9: 37,523,141 (GRCm39)	K49Q	possibly damaging	Het
St3gal6	C	T	16: 58,305,136 (GRCm39)	E109K	probably benign	Het
Stat4	A	G	1: 52,050,955 (GRCm39)	N5D	probably benign	Het
Tmem232	C	T	17: 65,689,520 (GRCm39)	D532N	probably benign	Het
Tmem232	C	A	17: 65,689,628 (GRCm39)	D496Y	possibly damaging	Het
Tmem81	A	G	1: 132,435,809 (GRCm39)	N205S	probably benign	Het
Tomm20l	C	T	12: 71,158,516 (GRCm39)	A58V	possibly damaging	Het
Ttn	A	G	2: 76,804,552 (GRCm39)	V240A	probably benign	Het
Vmn2r23	A	T	6: 123,718,348 (GRCm39)	N567I	probably damaging	Het

Other mutations in Sorcs3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00096:Sorcs3	APN	19	48,672,097 (GRCm39)	critical splice donor site	probably null
IGL00233:Sorcs3	APN	19	48,736,758 (GRCm39)	missense	probably benign	0.12
IGL00482:Sorcs3	APN	19	48,592,303 (GRCm39)	missense	probably benign	0.00
IGL00976:Sorcs3	APN	19	48,755,542 (GRCm39)	missense	probably damaging	1.00
IGL01367:Sorcs3	APN	19	48,784,814 (GRCm39)	missense	probably damaging	1.00
IGL01390:Sorcs3	APN	19	48,778,570 (GRCm39)	missense	probably damaging	1.00
IGL01548:Sorcs3	APN	19	48,782,607 (GRCm39)	missense	possibly damaging	0.87
IGL02162:Sorcs3	APN	19	48,523,970 (GRCm39)	missense	probably damaging	0.98
IGL02165:Sorcs3	APN	19	48,642,511 (GRCm39)	missense	probably benign	0.03
IGL02404:Sorcs3	APN	19	48,692,809 (GRCm39)	splice site	probably benign
IGL02830:Sorcs3	APN	19	48,711,441 (GRCm39)	splice site	probably null
IGL02943:Sorcs3	APN	19	48,748,377 (GRCm39)	missense	probably benign	0.00
R0371:Sorcs3	UTSW	19	48,592,333 (GRCm39)	missense	probably benign	0.00
R0456:Sorcs3	UTSW	19	48,642,483 (GRCm39)	missense	possibly damaging	0.94
R0466:Sorcs3	UTSW	19	48,736,758 (GRCm39)	missense	probably benign	0.12
R0470:Sorcs3	UTSW	19	48,785,956 (GRCm39)	critical splice donor site	probably null
R0536:Sorcs3	UTSW	19	48,791,137 (GRCm39)	nonsense	probably null
R0646:Sorcs3	UTSW	19	48,194,734 (GRCm39)	missense	probably benign	0.10
R0709:Sorcs3	UTSW	19	48,475,845 (GRCm39)	missense	probably benign
R0792:Sorcs3	UTSW	19	48,694,448 (GRCm39)	missense	possibly damaging	0.84
R0831:Sorcs3	UTSW	19	48,682,433 (GRCm39)	missense	probably damaging	1.00
R0836:Sorcs3	UTSW	19	48,475,833 (GRCm39)	missense	probably benign
R1253:Sorcs3	UTSW	19	48,195,175 (GRCm39)	missense	possibly damaging	0.67
R1390:Sorcs3	UTSW	19	48,682,440 (GRCm39)	critical splice donor site	probably null
R1522:Sorcs3	UTSW	19	48,694,448 (GRCm39)	missense	possibly damaging	0.84
R1570:Sorcs3	UTSW	19	48,752,620 (GRCm39)	missense	probably damaging	1.00
R1637:Sorcs3	UTSW	19	48,736,798 (GRCm39)	critical splice donor site	probably null
R1766:Sorcs3	UTSW	19	48,592,314 (GRCm39)	missense	possibly damaging	0.87
R1894:Sorcs3	UTSW	19	48,782,713 (GRCm39)	missense	probably benign	0.23
R2426:Sorcs3	UTSW	19	48,711,364 (GRCm39)	missense	probably damaging	1.00
R3818:Sorcs3	UTSW	19	48,592,343 (GRCm39)	missense	probably benign	0.00
R3824:Sorcs3	UTSW	19	48,711,395 (GRCm39)	missense	probably damaging	1.00
R3934:Sorcs3	UTSW	19	48,701,943 (GRCm39)	missense	probably damaging	1.00
R3936:Sorcs3	UTSW	19	48,701,943 (GRCm39)	missense	probably damaging	1.00
R4190:Sorcs3	UTSW	19	48,737,812 (GRCm39)	missense	possibly damaging	0.69
R4604:Sorcs3	UTSW	19	48,682,353 (GRCm39)	missense	probably benign	0.35
R4644:Sorcs3	UTSW	19	48,672,036 (GRCm39)	missense	probably damaging	1.00
R4774:Sorcs3	UTSW	19	48,782,602 (GRCm39)	missense	probably benign	0.23
R4801:Sorcs3	UTSW	19	48,387,183 (GRCm39)	missense	possibly damaging	0.46
R4802:Sorcs3	UTSW	19	48,387,183 (GRCm39)	missense	possibly damaging	0.46
R4945:Sorcs3	UTSW	19	48,752,587 (GRCm39)	missense	possibly damaging	0.50
R5049:Sorcs3	UTSW	19	48,748,390 (GRCm39)	missense	possibly damaging	0.93
R5175:Sorcs3	UTSW	19	48,748,284 (GRCm39)	critical splice acceptor site	probably null
R5342:Sorcs3	UTSW	19	48,784,911 (GRCm39)	splice site	probably null
R5848:Sorcs3	UTSW	19	48,776,950 (GRCm39)	missense	probably damaging	1.00
R5959:Sorcs3	UTSW	19	48,737,835 (GRCm39)	missense	probably damaging	1.00
R5977:Sorcs3	UTSW	19	48,784,889 (GRCm39)	missense	probably damaging	1.00
R6155:Sorcs3	UTSW	19	48,387,136 (GRCm39)	missense	possibly damaging	0.94
R6222:Sorcs3	UTSW	19	48,748,296 (GRCm39)	missense	possibly damaging	0.57
R6268:Sorcs3	UTSW	19	48,778,605 (GRCm39)	missense	probably damaging	1.00
R6416:Sorcs3	UTSW	19	48,791,198 (GRCm39)	missense	probably damaging	1.00
R6425:Sorcs3	UTSW	19	48,752,746 (GRCm39)	critical splice donor site	probably null
R6623:Sorcs3	UTSW	19	48,776,944 (GRCm39)	missense	probably benign	0.00
R6767:Sorcs3	UTSW	19	48,702,010 (GRCm39)	missense	probably damaging	0.99
R6888:Sorcs3	UTSW	19	48,682,263 (GRCm39)	missense	possibly damaging	0.83
R6955:Sorcs3	UTSW	19	48,737,782 (GRCm39)	missense	possibly damaging	0.82
R7106:Sorcs3	UTSW	19	48,694,402 (GRCm39)	missense	probably damaging	1.00
R7379:Sorcs3	UTSW	19	48,760,705 (GRCm39)	missense	possibly damaging	0.69
R7953:Sorcs3	UTSW	19	48,752,734 (GRCm39)	missense	possibly damaging	0.84
R8043:Sorcs3	UTSW	19	48,752,734 (GRCm39)	missense	possibly damaging	0.84
R8242:Sorcs3	UTSW	19	48,194,913 (GRCm39)	missense	possibly damaging	0.53
R8343:Sorcs3	UTSW	19	48,692,808 (GRCm39)	splice site	probably null
R8433:Sorcs3	UTSW	19	48,194,913 (GRCm39)	missense	possibly damaging	0.53
R8435:Sorcs3	UTSW	19	48,194,913 (GRCm39)	missense	possibly damaging	0.53
R8436:Sorcs3	UTSW	19	48,194,913 (GRCm39)	missense	possibly damaging	0.53
R8940:Sorcs3	UTSW	19	48,784,908 (GRCm39)	critical splice donor site	probably null
R8956:Sorcs3	UTSW	19	48,737,810 (GRCm39)	nonsense	probably null
R9051:Sorcs3	UTSW	19	48,194,809 (GRCm39)	missense	probably benign
R9119:Sorcs3	UTSW	19	48,642,433 (GRCm39)	missense	possibly damaging	0.92
R9166:Sorcs3	UTSW	19	48,784,811 (GRCm39)	missense	probably benign	0.01
R9328:Sorcs3	UTSW	19	48,785,950 (GRCm39)	missense	probably damaging	1.00
R9489:Sorcs3	UTSW	19	48,711,364 (GRCm39)	missense	probably damaging	1.00
R9605:Sorcs3	UTSW	19	48,711,364 (GRCm39)	missense	probably damaging	1.00
R9757:Sorcs3	UTSW	19	48,711,363 (GRCm39)	missense	probably damaging	1.00
X0018:Sorcs3	UTSW	19	48,760,728 (GRCm39)	missense	probably damaging	1.00
Z1176:Sorcs3	UTSW	19	48,634,243 (GRCm39)	missense	probably damaging	1.00
Z1177:Sorcs3	UTSW	19	48,692,739 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAATGCAAAGCACTGTCAGG -3'
(R):5'- TGCACTGGAGAGACAAGTTC -3'

Sequencing Primer
(F):5'- GCACTGTCAGGATTAAAATAAATGC -3'
(R):5'- CACTGGAGAGACAAGTTCTAGATTTC -3'

Posted On

2015-03-25