Incidental Mutation 'R3790:Asic4'
ID272465
Institutional Source Beutler Lab
Gene Symbol Asic4
Ensembl Gene ENSMUSG00000033007
Gene Nameacid-sensing (proton-gated) ion channel family member 4
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3790 (G1)
Quality Score215
Status Validated
Chromosome1
Chromosomal Location75450436-75474343 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 75469841 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037708] [ENSMUST00000079205] [ENSMUST00000094818] [ENSMUST00000113577] [ENSMUST00000138683]
Predicted Effect probably benign
Transcript: ENSMUST00000037708
SMART Domains Protein: ENSMUSP00000045598
Gene: ENSMUSG00000033007

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
Pfam:ASC 45 464 5.3e-92 PFAM
low complexity region 507 533 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079205
SMART Domains Protein: ENSMUSP00000078199
Gene: ENSMUSG00000032997

DomainStartEndE-ValueType
low complexity region 37 46 N/A INTRINSIC
Pfam:CHGN 262 761 5e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094818
SMART Domains Protein: ENSMUSP00000092412
Gene: ENSMUSG00000032997

DomainStartEndE-ValueType
Pfam:CHGN 100 599 3.3e-174 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113577
SMART Domains Protein: ENSMUSP00000109207
Gene: ENSMUSG00000033007

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
Pfam:ASC 45 346 5.5e-94 PFAM
Pfam:ASC 344 446 1.4e-42 PFAM
low complexity region 488 514 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138683
SMART Domains Protein: ENSMUSP00000117253
Gene: ENSMUSG00000032997

DomainStartEndE-ValueType
low complexity region 37 46 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194916
Meta Mutation Damage Score 0.0424 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the superfamily of acid-sensing ion channels, which are proton-gated, amiloride-sensitive sodium channels. These channels have been implicated in synaptic transmission, pain perception as well as mechanoperception. This gene is predominantly expressed in the pituitary gland, and was considered a candidate for paroxysmal dystonic choreoathetosis (PDC), a movement disorder, however, no correlation was found between mutations in this gene and PDC. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous knockout increases the fear response in the predator-odor induced fear test and increases anxiety in open field and elevated plus maze tests. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat3 G A 17: 12,928,573 Q186* probably null Het
Alk A G 17: 72,603,432 L93P possibly damaging Het
Ankrd24 C T 10: 81,642,679 probably benign Het
Anks6 A T 4: 47,049,212 V231E probably damaging Het
Ap5z1 C T 5: 142,470,413 S329L probably benign Het
Cers4 C A 8: 4,518,285 Q113K possibly damaging Het
Ces3b A T 8: 105,086,888 I264F possibly damaging Het
Cops3 T C 11: 59,827,971 M166V probably benign Het
Corin T C 5: 72,435,298 Q184R probably benign Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Drosha T A 15: 12,912,537 Y1080* probably null Het
Gm53 T C 11: 96,251,651 noncoding transcript Het
Hmcn1 A G 1: 150,622,994 S4045P probably benign Het
Kif22 A G 7: 127,029,496 L480P probably damaging Het
Lepr A T 4: 101,790,914 probably benign Het
Lnpk A T 2: 74,522,263 S358R probably benign Het
Lnx1 A G 5: 74,628,366 probably benign Het
Lrsam1 T C 2: 32,958,159 E43G probably null Het
Mug1 G A 6: 121,884,628 V1350I probably benign Het
Nbea T A 3: 56,005,029 E1112D probably benign Het
Nepn T A 10: 52,400,530 L60I probably damaging Het
Oas1e T C 5: 120,795,410 E30G probably damaging Het
Olfr1228 A G 2: 89,248,993 F234L probably benign Het
Olfr729 A C 14: 50,148,569 F102V possibly damaging Het
Pou2f1 G C 1: 165,894,969 P349R probably damaging Het
Prmt8 A T 6: 127,711,147 I236N probably damaging Het
Psg23 C A 7: 18,612,201 V190L probably benign Het
Psg29 A G 7: 17,205,025 K75E possibly damaging Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,219,203 probably benign Het
Rgs4 A G 1: 169,744,422 S103P probably damaging Het
Sis T C 3: 72,921,414 Y1144C probably damaging Het
Slc16a14 T C 1: 84,929,280 probably benign Het
Snrnp35 T A 5: 124,490,185 D20E probably damaging Het
Syce1l C A 8: 113,643,265 A10E possibly damaging Het
Tdp1 A G 12: 99,891,752 probably benign Het
Tmem2 T G 19: 21,807,452 I433S probably damaging Het
Tmem212 T C 3: 27,886,445 probably null Het
Tomm20l C T 12: 71,111,742 A58V possibly damaging Het
Ttn C A 2: 76,738,127 C27474F probably damaging Het
Ttn A G 2: 76,974,208 V240A probably benign Het
Vars A G 17: 34,999,334 V48A probably benign Het
Vmn2r1 T C 3: 64,086,764 probably null Het
Washc2 A G 6: 116,247,972 probably benign Het
Zfp943 A G 17: 21,992,422 D163G possibly damaging Het
Zmym5 T C 14: 56,793,773 Y626C probably damaging Het
Other mutations in Asic4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Asic4 APN 1 75469146 missense possibly damaging 0.94
IGL01470:Asic4 APN 1 75450866 missense probably damaging 1.00
IGL02645:Asic4 APN 1 75473354 unclassified probably benign
IGL03002:Asic4 APN 1 75451323 missense possibly damaging 0.61
positron UTSW 1 75473043 nonsense probably null
PIT4445001:Asic4 UTSW 1 75451127 missense probably benign 0.03
R0106:Asic4 UTSW 1 75451127 missense probably benign 0.03
R0138:Asic4 UTSW 1 75469687 missense possibly damaging 0.87
R0453:Asic4 UTSW 1 75473511 unclassified probably benign
R0573:Asic4 UTSW 1 75469102 splice site probably benign
R0705:Asic4 UTSW 1 75451370 missense probably damaging 1.00
R1892:Asic4 UTSW 1 75469482 missense probably damaging 1.00
R1912:Asic4 UTSW 1 75469232 missense possibly damaging 0.93
R3614:Asic4 UTSW 1 75473058 missense probably damaging 1.00
R3923:Asic4 UTSW 1 75451227 missense probably damaging 1.00
R4447:Asic4 UTSW 1 75470370 unclassified probably benign
R5177:Asic4 UTSW 1 75450839 missense probably damaging 1.00
R5208:Asic4 UTSW 1 75451226 missense probably damaging 1.00
R5266:Asic4 UTSW 1 75450923 missense probably benign 0.03
R5436:Asic4 UTSW 1 75451319 missense probably benign 0.09
R5921:Asic4 UTSW 1 75451373 missense probably benign 0.30
R6086:Asic4 UTSW 1 75473243 missense possibly damaging 0.64
R6512:Asic4 UTSW 1 75473043 nonsense probably null
R6530:Asic4 UTSW 1 75472335 missense probably damaging 0.98
R7545:Asic4 UTSW 1 75472416 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCTAACTTATCTGCCCCAGC -3'
(R):5'- TACAGTCTTCGGGTCATGCAC -3'

Sequencing Primer
(F):5'- AACTTATCTGCCCCAGCCTTGG -3'
(R):5'- TATATTAGCATGCACGCAAGC -3'
Posted On2015-03-25