Incidental Mutation 'R3790:Olfr1228'
ID272474
Institutional Source Beutler Lab
Gene Symbol Olfr1228
Ensembl Gene ENSMUSG00000099486
Gene Nameolfactory receptor 1228
SynonymsMOR233-1, GA_x6K02T2Q125-50696209-50695274
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R3790 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89247964-89254062 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89248993 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 234 (F234L)
Ref Sequence ENSEMBL: ENSMUSP00000139920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099789] [ENSMUST00000190757] [ENSMUST00000215447] [ENSMUST00000216392]
Predicted Effect probably benign
Transcript: ENSMUST00000099789
AA Change: F234L

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000097377
Gene: ENSMUSG00000101480
AA Change: F234L

DomainStartEndE-ValueType
Pfam:7tm_4 41 315 4.2e-48 PFAM
Pfam:7tm_1 51 298 4.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190757
AA Change: F234L

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000139920
Gene: ENSMUSG00000099486
AA Change: F234L

DomainStartEndE-ValueType
Pfam:7tm_1 51 298 2.6e-27 PFAM
Pfam:7tm_4 150 292 2.9e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215447
AA Change: F222L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000216392
AA Change: F222L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Meta Mutation Damage Score 0.126 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat3 G A 17: 12,928,573 Q186* probably null Het
Alk A G 17: 72,603,432 L93P possibly damaging Het
Ankrd24 C T 10: 81,642,679 probably benign Het
Anks6 A T 4: 47,049,212 V231E probably damaging Het
Ap5z1 C T 5: 142,470,413 S329L probably benign Het
Asic4 C A 1: 75,469,841 probably benign Het
Cers4 C A 8: 4,518,285 Q113K possibly damaging Het
Ces3b A T 8: 105,086,888 I264F possibly damaging Het
Cops3 T C 11: 59,827,971 M166V probably benign Het
Corin T C 5: 72,435,298 Q184R probably benign Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Drosha T A 15: 12,912,537 Y1080* probably null Het
Gm53 T C 11: 96,251,651 noncoding transcript Het
Hmcn1 A G 1: 150,622,994 S4045P probably benign Het
Kif22 A G 7: 127,029,496 L480P probably damaging Het
Lepr A T 4: 101,790,914 probably benign Het
Lnpk A T 2: 74,522,263 S358R probably benign Het
Lnx1 A G 5: 74,628,366 probably benign Het
Lrsam1 T C 2: 32,958,159 E43G probably null Het
Mug1 G A 6: 121,884,628 V1350I probably benign Het
Nbea T A 3: 56,005,029 E1112D probably benign Het
Nepn T A 10: 52,400,530 L60I probably damaging Het
Oas1e T C 5: 120,795,410 E30G probably damaging Het
Olfr729 A C 14: 50,148,569 F102V possibly damaging Het
Pou2f1 G C 1: 165,894,969 P349R probably damaging Het
Prmt8 A T 6: 127,711,147 I236N probably damaging Het
Psg23 C A 7: 18,612,201 V190L probably benign Het
Psg29 A G 7: 17,205,025 K75E possibly damaging Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,219,203 probably benign Het
Rgs4 A G 1: 169,744,422 S103P probably damaging Het
Sis T C 3: 72,921,414 Y1144C probably damaging Het
Slc16a14 T C 1: 84,929,280 probably benign Het
Snrnp35 T A 5: 124,490,185 D20E probably damaging Het
Syce1l C A 8: 113,643,265 A10E possibly damaging Het
Tdp1 A G 12: 99,891,752 probably benign Het
Tmem2 T G 19: 21,807,452 I433S probably damaging Het
Tmem212 T C 3: 27,886,445 probably null Het
Tomm20l C T 12: 71,111,742 A58V possibly damaging Het
Ttn C A 2: 76,738,127 C27474F probably damaging Het
Ttn A G 2: 76,974,208 V240A probably benign Het
Vars A G 17: 34,999,334 V48A probably benign Het
Vmn2r1 T C 3: 64,086,764 probably null Het
Washc2 A G 6: 116,247,972 probably benign Het
Zfp943 A G 17: 21,992,422 D163G possibly damaging Het
Zmym5 T C 14: 56,793,773 Y626C probably damaging Het
Other mutations in Olfr1228
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01804:Olfr1228 APN 2 89249222 missense probably benign 0.00
IGL02588:Olfr1228 APN 2 89249698 splice site probably benign
R0384:Olfr1228 UTSW 2 89249070 missense possibly damaging 0.82
R0600:Olfr1228 UTSW 2 89249398 nonsense probably null
R0613:Olfr1228 UTSW 2 89249125 missense probably damaging 1.00
R1564:Olfr1228 UTSW 2 89249672 missense probably benign 0.00
R2115:Olfr1228 UTSW 2 89249530 missense probably damaging 1.00
R2313:Olfr1228 UTSW 2 89248941 missense probably damaging 1.00
R3083:Olfr1228 UTSW 2 89249001 missense probably damaging 0.96
R3948:Olfr1228 UTSW 2 89248992 missense possibly damaging 0.95
R4373:Olfr1228 UTSW 2 89249245 missense possibly damaging 0.90
R4376:Olfr1228 UTSW 2 89249245 missense possibly damaging 0.90
R4825:Olfr1228 UTSW 2 89248690 utr 3 prime probably null
R5022:Olfr1228 UTSW 2 89249417 missense probably benign 0.00
R5141:Olfr1228 UTSW 2 89249129 nonsense probably null
R5313:Olfr1228 UTSW 2 89249377 missense probably benign 0.05
R6010:Olfr1228 UTSW 2 89248743 missense probably benign 0.00
R7354:Olfr1228 UTSW 2 89248687 utr 3 prime probably null
R7548:Olfr1228 UTSW 2 89249086 missense not run
Predicted Primers PCR Primer
(F):5'- ACCATAGGATTCAGAAGTGGTG -3'
(R):5'- ATGACCAGGAGACTCTGTGG -3'

Sequencing Primer
(F):5'- CCATAGGATTCAGAAGTGGTGTTATG -3'
(R):5'- GGACAGGAGGATTCTTACATTCTCTC -3'
Posted On2015-03-25