Incidental Mutation 'R3790:Ces3b'
ID272495
Institutional Source Beutler Lab
Gene Symbol Ces3b
Ensembl Gene ENSMUSG00000062181
Gene Namecarboxylesterase 3B
SynonymsES31L, Gm4738
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.013) question?
Stock #R3790 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location105083753-105093929 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 105086888 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 264 (I264F)
Ref Sequence ENSEMBL: ENSMUSP00000090909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074403] [ENSMUST00000093221] [ENSMUST00000173088]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074403
AA Change: I264F

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000074004
Gene: ENSMUSG00000062181
AA Change: I264F

DomainStartEndE-ValueType
Pfam:COesterase 13 436 1.8e-127 PFAM
Pfam:Abhydrolase_3 147 303 2.8e-13 PFAM
Pfam:COesterase 423 497 5.8e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000093221
AA Change: I264F

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000090909
Gene: ENSMUSG00000062181
AA Change: I264F

DomainStartEndE-ValueType
Pfam:COesterase 13 547 9.5e-163 PFAM
Pfam:Abhydrolase_3 147 304 2.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173088
SMART Domains Protein: ENSMUSP00000134204
Gene: ENSMUSG00000062181

DomainStartEndE-ValueType
Pfam:COesterase 1 114 2e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173838
Meta Mutation Damage Score 0.0964 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat3 G A 17: 12,928,573 Q186* probably null Het
Alk A G 17: 72,603,432 L93P possibly damaging Het
Ankrd24 C T 10: 81,642,679 probably benign Het
Anks6 A T 4: 47,049,212 V231E probably damaging Het
Ap5z1 C T 5: 142,470,413 S329L probably benign Het
Asic4 C A 1: 75,469,841 probably benign Het
Cers4 C A 8: 4,518,285 Q113K possibly damaging Het
Cops3 T C 11: 59,827,971 M166V probably benign Het
Corin T C 5: 72,435,298 Q184R probably benign Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Drosha T A 15: 12,912,537 Y1080* probably null Het
Gm53 T C 11: 96,251,651 noncoding transcript Het
Hmcn1 A G 1: 150,622,994 S4045P probably benign Het
Kif22 A G 7: 127,029,496 L480P probably damaging Het
Lepr A T 4: 101,790,914 probably benign Het
Lnpk A T 2: 74,522,263 S358R probably benign Het
Lnx1 A G 5: 74,628,366 probably benign Het
Lrsam1 T C 2: 32,958,159 E43G probably null Het
Mug1 G A 6: 121,884,628 V1350I probably benign Het
Nbea T A 3: 56,005,029 E1112D probably benign Het
Nepn T A 10: 52,400,530 L60I probably damaging Het
Oas1e T C 5: 120,795,410 E30G probably damaging Het
Olfr1228 A G 2: 89,248,993 F234L probably benign Het
Olfr729 A C 14: 50,148,569 F102V possibly damaging Het
Pou2f1 G C 1: 165,894,969 P349R probably damaging Het
Prmt8 A T 6: 127,711,147 I236N probably damaging Het
Psg23 C A 7: 18,612,201 V190L probably benign Het
Psg29 A G 7: 17,205,025 K75E possibly damaging Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,219,203 probably benign Het
Rgs4 A G 1: 169,744,422 S103P probably damaging Het
Sis T C 3: 72,921,414 Y1144C probably damaging Het
Slc16a14 T C 1: 84,929,280 probably benign Het
Snrnp35 T A 5: 124,490,185 D20E probably damaging Het
Syce1l C A 8: 113,643,265 A10E possibly damaging Het
Tdp1 A G 12: 99,891,752 probably benign Het
Tmem2 T G 19: 21,807,452 I433S probably damaging Het
Tmem212 T C 3: 27,886,445 probably null Het
Tomm20l C T 12: 71,111,742 A58V possibly damaging Het
Ttn C A 2: 76,738,127 C27474F probably damaging Het
Ttn A G 2: 76,974,208 V240A probably benign Het
Vars A G 17: 34,999,334 V48A probably benign Het
Vmn2r1 T C 3: 64,086,764 probably null Het
Washc2 A G 6: 116,247,972 probably benign Het
Zfp943 A G 17: 21,992,422 D163G possibly damaging Het
Zmym5 T C 14: 56,793,773 Y626C probably damaging Het
Other mutations in Ces3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Ces3b APN 8 105091574 missense probably benign 0.00
IGL01324:Ces3b APN 8 105093252 missense probably damaging 0.99
IGL02418:Ces3b APN 8 105085647 missense probably damaging 1.00
IGL02612:Ces3b APN 8 105085269 missense possibly damaging 0.83
IGL03400:Ces3b APN 8 105092936 missense probably damaging 1.00
R0244:Ces3b UTSW 8 105092635 missense probably damaging 1.00
R0282:Ces3b UTSW 8 105083851 missense probably benign 0.00
R0800:Ces3b UTSW 8 105085269 missense possibly damaging 0.83
R1833:Ces3b UTSW 8 105085639 missense probably damaging 0.98
R2130:Ces3b UTSW 8 105092975 critical splice donor site probably null
R4827:Ces3b UTSW 8 105086895 missense probably benign 0.12
R5411:Ces3b UTSW 8 105088632 missense possibly damaging 0.94
R5790:Ces3b UTSW 8 105092638 missense probably damaging 1.00
R5798:Ces3b UTSW 8 105088440 missense probably damaging 1.00
R5929:Ces3b UTSW 8 105093165 missense probably damaging 1.00
R6437:Ces3b UTSW 8 105092606 missense probably damaging 1.00
R6470:Ces3b UTSW 8 105088653 missense possibly damaging 0.87
R6943:Ces3b UTSW 8 105093078 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGATTGTCTCATCCCTGGTGAG -3'
(R):5'- AAAGCCTTGTCTGACTGCCTAC -3'

Sequencing Primer
(F):5'- TCATCCCTGGTGAGTGACC -3'
(R):5'- CCTGGACTGCACTAGCCAATTG -3'
Posted On2015-03-25