Incidental Mutation 'R3791:Alx3'
ID272519
Institutional Source Beutler Lab
Gene Symbol Alx3
Ensembl Gene ENSMUSG00000014603
Gene Namearistaless-like homeobox 3
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3791 (G1)
Quality Score82
Status Not validated
Chromosome3
Chromosomal Location107595031-107605776 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107600706 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 177 (Y177F)
Ref Sequence ENSEMBL: ENSMUSP00000014747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014747]
Predicted Effect probably damaging
Transcript: ENSMUST00000014747
AA Change: Y177F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000014747
Gene: ENSMUSG00000014603
AA Change: Y177F

DomainStartEndE-ValueType
low complexity region 12 28 N/A INTRINSIC
low complexity region 32 48 N/A INTRINSIC
low complexity region 90 102 N/A INTRINSIC
HOX 153 215 1.06e-25 SMART
low complexity region 248 258 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene belongs to Group 1 of aristaless-like genes, which are characterized by the presence of an aristaless domain and a conserved paired-like homeodomain. The encoded protein acts as a transcriptional regulator. The protein plays a role in the development of craniofacial and appendicular skeleton and may have a role in pancreatic function. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous mutation of this gene results in defects in glucose metabolism. Mice homozygous for a reporter allele exhibit partial preweaning lethality, open neural tube and craniofacial defects in some mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik AGGTGGTGGTGGTGGTGGTGGTGG AGGTGGTGGTGGTGGTGGTGG 6: 132,626,516 probably benign Het
A930009A15Rik A T 10: 115,578,289 probably benign Het
Adgrv1 T C 13: 81,593,102 Y81C probably damaging Het
C6 A G 15: 4,735,235 T138A probably benign Het
Cacna2d3 T C 14: 29,183,581 M410V probably benign Het
Celsr3 G A 9: 108,842,552 R2450H probably benign Het
Cnrip1 C T 11: 17,054,845 probably benign Het
Col6a5 A C 9: 105,864,669 D2350E probably damaging Het
Cyp4a12b A G 4: 115,434,970 I407V probably benign Het
Gpx4 A G 10: 80,056,189 I245V probably benign Het
H2-K1 A G 17: 33,999,525 I139T probably benign Het
Hmgcl A G 4: 135,959,987 K191R probably benign Het
Hpdl A G 4: 116,820,532 V244A possibly damaging Het
Hpse A G 5: 100,692,238 S338P probably damaging Het
Ifi203 T C 1: 173,935,080 K162R possibly damaging Het
Kit A G 5: 75,639,150 N514S probably damaging Het
Kmt2d G A 15: 98,844,149 probably benign Het
Limd1 T A 9: 123,480,374 S379R possibly damaging Het
Llph A G 10: 120,228,155 K59E probably benign Het
Lrrc7 T A 3: 158,163,956 M709L probably benign Het
Muc5ac A G 7: 141,798,501 S665G probably benign Het
Ncapd3 C T 9: 27,052,635 H524Y probably benign Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Olfr571 T C 7: 102,909,032 D269G probably benign Het
Papd5 G A 8: 88,243,329 E210K probably damaging Het
Phtf2 T C 5: 20,782,298 E400G probably damaging Het
Pkd1l3 T C 8: 109,636,317 V1080A probably damaging Het
Plch1 A T 3: 63,699,523 H1007Q probably benign Het
Prr5 T C 15: 84,681,216 S3P probably damaging Het
Qtrt1 G A 9: 21,419,340 D279N probably damaging Het
Rundc1 G A 11: 101,434,201 A578T probably damaging Het
Shc4 A T 2: 125,723,331 V16E probably damaging Het
Sik3 A T 9: 46,194,822 L329F possibly damaging Het
Slc36a3 A G 11: 55,125,156 S391P possibly damaging Het
Smad1 C A 8: 79,339,770 R426L probably damaging Het
Thrap3 A T 4: 126,167,500 N820K possibly damaging Het
Tnrc6b T C 15: 80,923,640 S1598P probably damaging Het
Ttn T C 2: 76,714,824 I32645V probably damaging Het
Wisp1 A G 15: 66,919,288 Y313C probably damaging Het
Zfp266 A C 9: 20,499,481 Y467D probably damaging Het
Zfp526 T A 7: 25,226,203 M629K probably damaging Het
Zfp788 A T 7: 41,649,728 H596L probably damaging Het
Zhx3 A G 2: 160,780,448 W600R possibly damaging Het
Other mutations in Alx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01486:Alx3 APN 3 107604823 missense probably damaging 1.00
IGL02537:Alx3 APN 3 107604859 missense possibly damaging 0.76
R0003:Alx3 UTSW 3 107604976 missense probably damaging 1.00
R1142:Alx3 UTSW 3 107600664 missense possibly damaging 0.95
R4322:Alx3 UTSW 3 107595375 missense probably benign
R4769:Alx3 UTSW 3 107600691 missense probably damaging 1.00
R4868:Alx3 UTSW 3 107600627 missense possibly damaging 0.58
R5072:Alx3 UTSW 3 107604793 missense possibly damaging 0.85
R5200:Alx3 UTSW 3 107600664 missense possibly damaging 0.95
R5640:Alx3 UTSW 3 107600661 missense probably damaging 1.00
R5801:Alx3 UTSW 3 107604941 nonsense probably null
X0066:Alx3 UTSW 3 107605079 makesense probably null
Predicted Primers PCR Primer
(F):5'- ACGGACCCTCTAATGTGCAAG -3'
(R):5'- CTGAAGGCTGAGCTCCAAAAG -3'

Sequencing Primer
(F):5'- TAATGTGCAAGCTTCCCCGG -3'
(R):5'- TCCAAAAGGCCAGGTGC -3'
Posted On2015-03-25