Incidental Mutation 'R3791:Hpdl'
ID272522
Institutional Source Beutler Lab
Gene Symbol Hpdl
Ensembl Gene ENSMUSG00000043155
Gene Name4-hydroxyphenylpyruvate dioxygenase-like
SynonymsA830048M07Rik, Gloxd1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.325) question?
Stock #R3791 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location116819904-116821707 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116820532 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 244 (V244A)
Ref Sequence ENSEMBL: ENSMUSP00000062327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055436] [ENSMUST00000102699] [ENSMUST00000130359] [ENSMUST00000155346]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055436
AA Change: V244A

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000062327
Gene: ENSMUSG00000043155
AA Change: V244A

DomainStartEndE-ValueType
SCOP:d1cjxa2 3 144 6e-7 SMART
PDB:1T47|B 4 367 8e-32 PDB
SCOP:d1cjxa2 161 367 5e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102699
SMART Domains Protein: ENSMUSP00000099760
Gene: ENSMUSG00000028687

DomainStartEndE-ValueType
ENDO3c 107 259 1.46e-52 SMART
FES 260 280 2.16e-5 SMART
Pfam:NUDIX_4 353 463 2.3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124857
Predicted Effect probably benign
Transcript: ENSMUST00000130359
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135449
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138056
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151670
Predicted Effect probably benign
Transcript: ENSMUST00000155346
SMART Domains Protein: ENSMUSP00000122777
Gene: ENSMUSG00000028687

DomainStartEndE-ValueType
PDB:3N5N|Y 50 100 3e-20 PDB
SCOP:d1keaa_ 59 86 3e-3 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik AGGTGGTGGTGGTGGTGGTGGTGG AGGTGGTGGTGGTGGTGGTGG 6: 132,626,516 probably benign Het
A930009A15Rik A T 10: 115,578,289 probably benign Het
Adgrv1 T C 13: 81,593,102 Y81C probably damaging Het
Alx3 A T 3: 107,600,706 Y177F probably damaging Het
C6 A G 15: 4,735,235 T138A probably benign Het
Cacna2d3 T C 14: 29,183,581 M410V probably benign Het
Celsr3 G A 9: 108,842,552 R2450H probably benign Het
Cnrip1 C T 11: 17,054,845 probably benign Het
Col6a5 A C 9: 105,864,669 D2350E probably damaging Het
Cyp4a12b A G 4: 115,434,970 I407V probably benign Het
Gpx4 A G 10: 80,056,189 I245V probably benign Het
H2-K1 A G 17: 33,999,525 I139T probably benign Het
Hmgcl A G 4: 135,959,987 K191R probably benign Het
Hpse A G 5: 100,692,238 S338P probably damaging Het
Ifi203 T C 1: 173,935,080 K162R possibly damaging Het
Kit A G 5: 75,639,150 N514S probably damaging Het
Kmt2d G A 15: 98,844,149 probably benign Het
Limd1 T A 9: 123,480,374 S379R possibly damaging Het
Llph A G 10: 120,228,155 K59E probably benign Het
Lrrc7 T A 3: 158,163,956 M709L probably benign Het
Muc5ac A G 7: 141,798,501 S665G probably benign Het
Ncapd3 C T 9: 27,052,635 H524Y probably benign Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Olfr571 T C 7: 102,909,032 D269G probably benign Het
Papd5 G A 8: 88,243,329 E210K probably damaging Het
Phtf2 T C 5: 20,782,298 E400G probably damaging Het
Pkd1l3 T C 8: 109,636,317 V1080A probably damaging Het
Plch1 A T 3: 63,699,523 H1007Q probably benign Het
Prr5 T C 15: 84,681,216 S3P probably damaging Het
Qtrt1 G A 9: 21,419,340 D279N probably damaging Het
Rundc1 G A 11: 101,434,201 A578T probably damaging Het
Shc4 A T 2: 125,723,331 V16E probably damaging Het
Sik3 A T 9: 46,194,822 L329F possibly damaging Het
Slc36a3 A G 11: 55,125,156 S391P possibly damaging Het
Smad1 C A 8: 79,339,770 R426L probably damaging Het
Thrap3 A T 4: 126,167,500 N820K possibly damaging Het
Tnrc6b T C 15: 80,923,640 S1598P probably damaging Het
Ttn T C 2: 76,714,824 I32645V probably damaging Het
Wisp1 A G 15: 66,919,288 Y313C probably damaging Het
Zfp266 A C 9: 20,499,481 Y467D probably damaging Het
Zfp526 T A 7: 25,226,203 M629K probably damaging Het
Zfp788 A T 7: 41,649,728 H596L probably damaging Het
Zhx3 A G 2: 160,780,448 W600R possibly damaging Het
Other mutations in Hpdl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Hpdl APN 4 116820944 missense possibly damaging 0.78
IGL02166:Hpdl APN 4 116820952 missense probably damaging 0.99
IGL02818:Hpdl APN 4 116820242 missense probably damaging 1.00
IGL02886:Hpdl APN 4 116820755 missense probably benign
R0403:Hpdl UTSW 4 116820479 missense possibly damaging 0.89
R0605:Hpdl UTSW 4 116820787 missense possibly damaging 0.87
R1565:Hpdl UTSW 4 116820883 missense probably damaging 1.00
R4736:Hpdl UTSW 4 116821024 missense probably damaging 1.00
R4740:Hpdl UTSW 4 116821024 missense probably damaging 1.00
R5681:Hpdl UTSW 4 116820842 missense probably benign 0.40
R5781:Hpdl UTSW 4 116820578 missense probably damaging 1.00
Z1088:Hpdl UTSW 4 116820833 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTAGAAGGCCAGGCTTGTG -3'
(R):5'- TGCTTATGCGCTGGTTCCAC -3'

Sequencing Primer
(F):5'- GGCTGCTGGTAATAAGCT -3'
(R):5'- TGGTTCCACGACTGCCTAG -3'
Posted On2015-03-25