Incidental Mutation 'R3791:Thrap3'
ID272523
Institutional Source Beutler Lab
Gene Symbol Thrap3
Ensembl Gene ENSMUSG00000043962
Gene Namethyroid hormone receptor associated protein 3
Synonyms9330151F09Rik, B230333E16Rik, Trap150
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.260) question?
Stock #R3791 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location126164082-126202760 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 126167500 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 820 (N820K)
Ref Sequence ENSEMBL: ENSMUSP00000079722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080919] [ENSMUST00000094760] [ENSMUST00000097891] [ENSMUST00000163176]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080919
AA Change: N820K

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000079722
Gene: ENSMUSG00000043962
AA Change: N820K

DomainStartEndE-ValueType
low complexity region 2 55 N/A INTRINSIC
low complexity region 77 95 N/A INTRINSIC
low complexity region 99 108 N/A INTRINSIC
Pfam:THRAP3_BCLAF1 123 788 1.9e-207 PFAM
low complexity region 790 801 N/A INTRINSIC
low complexity region 835 854 N/A INTRINSIC
low complexity region 892 910 N/A INTRINSIC
low complexity region 924 938 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094760
SMART Domains Protein: ENSMUSP00000092352
Gene: ENSMUSG00000073758

DomainStartEndE-ValueType
SH3 68 125 7.11e-22 SMART
low complexity region 211 221 N/A INTRINSIC
low complexity region 464 473 N/A INTRINSIC
coiled coil region 482 510 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097891
SMART Domains Protein: ENSMUSP00000095501
Gene: ENSMUSG00000073758

DomainStartEndE-ValueType
SH3 1 57 4.29e-7 SMART
low complexity region 66 76 N/A INTRINSIC
SH3 86 141 2.96e-19 SMART
SH3 184 241 7.11e-22 SMART
low complexity region 327 337 N/A INTRINSIC
low complexity region 580 589 N/A INTRINSIC
coiled coil region 598 626 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154702
Predicted Effect probably benign
Transcript: ENSMUST00000163176
Predicted Effect unknown
Transcript: ENSMUST00000163459
AA Change: N110K
SMART Domains Protein: ENSMUSP00000129775
Gene: ENSMUSG00000043962
AA Change: N110K

DomainStartEndE-ValueType
Pfam:THRAP3_BCLAF1 1 39 4e-17 PFAM
low complexity region 41 58 N/A INTRINSIC
low complexity region 59 77 N/A INTRINSIC
low complexity region 81 92 N/A INTRINSIC
Pfam:Btz 124 192 3.1e-4 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik AGGTGGTGGTGGTGGTGGTGGTGG AGGTGGTGGTGGTGGTGGTGG 6: 132,626,516 probably benign Het
A930009A15Rik A T 10: 115,578,289 probably benign Het
Adgrv1 T C 13: 81,593,102 Y81C probably damaging Het
Alx3 A T 3: 107,600,706 Y177F probably damaging Het
C6 A G 15: 4,735,235 T138A probably benign Het
Cacna2d3 T C 14: 29,183,581 M410V probably benign Het
Celsr3 G A 9: 108,842,552 R2450H probably benign Het
Cnrip1 C T 11: 17,054,845 probably benign Het
Col6a5 A C 9: 105,864,669 D2350E probably damaging Het
Cyp4a12b A G 4: 115,434,970 I407V probably benign Het
Gpx4 A G 10: 80,056,189 I245V probably benign Het
H2-K1 A G 17: 33,999,525 I139T probably benign Het
Hmgcl A G 4: 135,959,987 K191R probably benign Het
Hpdl A G 4: 116,820,532 V244A possibly damaging Het
Hpse A G 5: 100,692,238 S338P probably damaging Het
Ifi203 T C 1: 173,935,080 K162R possibly damaging Het
Kit A G 5: 75,639,150 N514S probably damaging Het
Kmt2d G A 15: 98,844,149 probably benign Het
Limd1 T A 9: 123,480,374 S379R possibly damaging Het
Llph A G 10: 120,228,155 K59E probably benign Het
Lrrc7 T A 3: 158,163,956 M709L probably benign Het
Muc5ac A G 7: 141,798,501 S665G probably benign Het
Ncapd3 C T 9: 27,052,635 H524Y probably benign Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Olfr571 T C 7: 102,909,032 D269G probably benign Het
Papd5 G A 8: 88,243,329 E210K probably damaging Het
Phtf2 T C 5: 20,782,298 E400G probably damaging Het
Pkd1l3 T C 8: 109,636,317 V1080A probably damaging Het
Plch1 A T 3: 63,699,523 H1007Q probably benign Het
Prr5 T C 15: 84,681,216 S3P probably damaging Het
Qtrt1 G A 9: 21,419,340 D279N probably damaging Het
Rundc1 G A 11: 101,434,201 A578T probably damaging Het
Shc4 A T 2: 125,723,331 V16E probably damaging Het
Sik3 A T 9: 46,194,822 L329F possibly damaging Het
Slc36a3 A G 11: 55,125,156 S391P possibly damaging Het
Smad1 C A 8: 79,339,770 R426L probably damaging Het
Tnrc6b T C 15: 80,923,640 S1598P probably damaging Het
Ttn T C 2: 76,714,824 I32645V probably damaging Het
Wisp1 A G 15: 66,919,288 Y313C probably damaging Het
Zfp266 A C 9: 20,499,481 Y467D probably damaging Het
Zfp526 T A 7: 25,226,203 M629K probably damaging Het
Zfp788 A T 7: 41,649,728 H596L probably damaging Het
Zhx3 A G 2: 160,780,448 W600R possibly damaging Het
Other mutations in Thrap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Thrap3 APN 4 126165578 missense probably benign 0.01
IGL00654:Thrap3 APN 4 126165578 missense probably benign 0.01
IGL00763:Thrap3 APN 4 126165578 missense probably benign 0.01
IGL00907:Thrap3 APN 4 126165578 missense probably benign 0.01
IGL00990:Thrap3 APN 4 126165395 unclassified probably benign
IGL01722:Thrap3 APN 4 126165529 missense possibly damaging 0.87
IGL02487:Thrap3 APN 4 126167001 missense possibly damaging 0.93
IGL02802:Thrap3 UTSW 4 126165364 unclassified probably benign
IGL02837:Thrap3 UTSW 4 126165364 unclassified probably benign
IGL02988:Thrap3 UTSW 4 126165542 splice site probably null
IGL03050:Thrap3 UTSW 4 126165542 splice site probably null
IGL03055:Thrap3 UTSW 4 126165542 splice site probably null
R0585:Thrap3 UTSW 4 126178574 unclassified probably null
R1023:Thrap3 UTSW 4 126180089 missense possibly damaging 0.73
R1237:Thrap3 UTSW 4 126180069 missense probably benign 0.02
R1445:Thrap3 UTSW 4 126176336 missense probably damaging 1.00
R1601:Thrap3 UTSW 4 126180101 missense probably damaging 1.00
R2058:Thrap3 UTSW 4 126180174 missense probably damaging 1.00
R2063:Thrap3 UTSW 4 126175396 missense possibly damaging 0.57
R2064:Thrap3 UTSW 4 126175396 missense possibly damaging 0.57
R2065:Thrap3 UTSW 4 126175396 missense possibly damaging 0.57
R2066:Thrap3 UTSW 4 126175396 missense possibly damaging 0.57
R2067:Thrap3 UTSW 4 126175396 missense possibly damaging 0.57
R2098:Thrap3 UTSW 4 126180030 missense probably damaging 1.00
R4052:Thrap3 UTSW 4 126176219 missense probably damaging 1.00
R4097:Thrap3 UTSW 4 126171802 missense probably damaging 1.00
R4153:Thrap3 UTSW 4 126173442 critical splice donor site probably null
R4399:Thrap3 UTSW 4 126167079 splice site probably benign
R5265:Thrap3 UTSW 4 126167640 missense probably damaging 1.00
R5687:Thrap3 UTSW 4 126180486 unclassified probably benign
R5993:Thrap3 UTSW 4 126175460 unclassified probably null
R6305:Thrap3 UTSW 4 126180807 unclassified probably benign
R6917:Thrap3 UTSW 4 126180492 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CTTCAATCAGGATCTAAGGTGCAG -3'
(R):5'- TAATGTAGGAAGCACCGCAG -3'

Sequencing Primer
(F):5'- AGCTATAAAAGGCTTTGGAAGTG -3'
(R):5'- CAGAGCAAGAGACCGGTCC -3'
Posted On2015-03-25