Incidental Mutation 'R3791:Hmgcl'
ID272524
Institutional Source Beutler Lab
Gene Symbol Hmgcl
Ensembl Gene ENSMUSG00000028672
Gene Name3-hydroxy-3-methylglutaryl-Coenzyme A lyase
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3791 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location135946448-135962617 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135959987 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 191 (K191R)
Ref Sequence ENSEMBL: ENSMUSP00000030432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030432] [ENSMUST00000102541] [ENSMUST00000143304] [ENSMUST00000149636]
Predicted Effect probably benign
Transcript: ENSMUST00000030432
AA Change: K191R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000030432
Gene: ENSMUSG00000028672
AA Change: K191R

DomainStartEndE-ValueType
Pfam:HMGL-like 32 306 2.4e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102541
SMART Domains Protein: ENSMUSP00000099600
Gene: ENSMUSG00000028671

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 1 184 3.5e-14 PFAM
Pfam:KR 3 144 9.5e-10 PFAM
Pfam:Polysacc_synt_2 4 193 7.6e-14 PFAM
Pfam:Epimerase 4 269 3.5e-54 PFAM
Pfam:3Beta_HSD 5 172 2e-18 PFAM
Pfam:GDP_Man_Dehyd 5 332 2.5e-60 PFAM
Pfam:NAD_binding_4 62 233 2.5e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128929
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135644
Predicted Effect probably benign
Transcript: ENSMUST00000143304
SMART Domains Protein: ENSMUSP00000119514
Gene: ENSMUSG00000028671

DomainStartEndE-ValueType
Pfam:Epimerase 4 55 1.2e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148613
Predicted Effect probably benign
Transcript: ENSMUST00000149636
SMART Domains Protein: ENSMUSP00000117923
Gene: ENSMUSG00000028671

DomainStartEndE-ValueType
Pfam:Epimerase 4 58 1.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151879
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the HMG-CoA lyase family. It is a mitochondrial enzyme that catalyzes the final step of leucine degradation and plays a key role in ketone body formation. Mutations in this gene are associated with HMG-CoA lyase deficiency. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele die at midgestation exhibiting reduced embryo size, frequent cytoplasmic vacuolization in liver, heart and placenta, and marked focal hydropic swelling of mitochondria in hepatocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik AGGTGGTGGTGGTGGTGGTGGTGG AGGTGGTGGTGGTGGTGGTGG 6: 132,626,516 probably benign Het
A930009A15Rik A T 10: 115,578,289 probably benign Het
Adgrv1 T C 13: 81,593,102 Y81C probably damaging Het
Alx3 A T 3: 107,600,706 Y177F probably damaging Het
C6 A G 15: 4,735,235 T138A probably benign Het
Cacna2d3 T C 14: 29,183,581 M410V probably benign Het
Celsr3 G A 9: 108,842,552 R2450H probably benign Het
Cnrip1 C T 11: 17,054,845 probably benign Het
Col6a5 A C 9: 105,864,669 D2350E probably damaging Het
Cyp4a12b A G 4: 115,434,970 I407V probably benign Het
Gpx4 A G 10: 80,056,189 I245V probably benign Het
H2-K1 A G 17: 33,999,525 I139T probably benign Het
Hpdl A G 4: 116,820,532 V244A possibly damaging Het
Hpse A G 5: 100,692,238 S338P probably damaging Het
Ifi203 T C 1: 173,935,080 K162R possibly damaging Het
Kit A G 5: 75,639,150 N514S probably damaging Het
Kmt2d G A 15: 98,844,149 probably benign Het
Limd1 T A 9: 123,480,374 S379R possibly damaging Het
Llph A G 10: 120,228,155 K59E probably benign Het
Lrrc7 T A 3: 158,163,956 M709L probably benign Het
Muc5ac A G 7: 141,798,501 S665G probably benign Het
Ncapd3 C T 9: 27,052,635 H524Y probably benign Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Olfr571 T C 7: 102,909,032 D269G probably benign Het
Papd5 G A 8: 88,243,329 E210K probably damaging Het
Phtf2 T C 5: 20,782,298 E400G probably damaging Het
Pkd1l3 T C 8: 109,636,317 V1080A probably damaging Het
Plch1 A T 3: 63,699,523 H1007Q probably benign Het
Prr5 T C 15: 84,681,216 S3P probably damaging Het
Qtrt1 G A 9: 21,419,340 D279N probably damaging Het
Rundc1 G A 11: 101,434,201 A578T probably damaging Het
Shc4 A T 2: 125,723,331 V16E probably damaging Het
Sik3 A T 9: 46,194,822 L329F possibly damaging Het
Slc36a3 A G 11: 55,125,156 S391P possibly damaging Het
Smad1 C A 8: 79,339,770 R426L probably damaging Het
Thrap3 A T 4: 126,167,500 N820K possibly damaging Het
Tnrc6b T C 15: 80,923,640 S1598P probably damaging Het
Ttn T C 2: 76,714,824 I32645V probably damaging Het
Wisp1 A G 15: 66,919,288 Y313C probably damaging Het
Zfp266 A C 9: 20,499,481 Y467D probably damaging Het
Zfp526 T A 7: 25,226,203 M629K probably damaging Het
Zfp788 A T 7: 41,649,728 H596L probably damaging Het
Zhx3 A G 2: 160,780,448 W600R possibly damaging Het
Other mutations in Hmgcl
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0226:Hmgcl UTSW 4 135958728 missense probably damaging 1.00
R0825:Hmgcl UTSW 4 135960070 missense probably benign
R2400:Hmgcl UTSW 4 135952368 splice site probably null
R4063:Hmgcl UTSW 4 135958724 missense probably damaging 1.00
R5000:Hmgcl UTSW 4 135962200 missense probably benign 0.01
R5754:Hmgcl UTSW 4 135950587 missense probably damaging 0.98
R6024:Hmgcl UTSW 4 135955615 missense probably benign 0.09
R6658:Hmgcl UTSW 4 135955651 missense probably damaging 0.96
R6889:Hmgcl UTSW 4 135955642 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TTGCAGCCACTGGGTAATGC -3'
(R):5'- ACGATGAAATGGTACTTCCCTGC -3'

Sequencing Primer
(F):5'- AGCCACTGGGTAATGCTGGTC -3'
(R):5'- AATATGGGCGCACGGCTTTC -3'
Posted On2015-03-25