Incidental Mutation 'R3791:Phtf2'
ID272525
Institutional Source Beutler Lab
Gene Symbol Phtf2
Ensembl Gene ENSMUSG00000039987
Gene Nameputative homeodomain transcription factor 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.248) question?
Stock #R3791 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location20758663-20882124 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20782298 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 400 (E400G)
Ref Sequence ENSEMBL: ENSMUSP00000114087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118174]
Predicted Effect probably damaging
Transcript: ENSMUST00000118174
AA Change: E400G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000114087
Gene: ENSMUSG00000039987
AA Change: E400G

DomainStartEndE-ValueType
Pfam:Phtf-FEM1B_bdg 5 154 1.3e-76 PFAM
low complexity region 340 359 N/A INTRINSIC
transmembrane domain 457 479 N/A INTRINSIC
transmembrane domain 511 533 N/A INTRINSIC
transmembrane domain 596 618 N/A INTRINSIC
transmembrane domain 628 647 N/A INTRINSIC
transmembrane domain 715 737 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124431
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133784
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik AGGTGGTGGTGGTGGTGGTGGTGG AGGTGGTGGTGGTGGTGGTGG 6: 132,626,516 probably benign Het
A930009A15Rik A T 10: 115,578,289 probably benign Het
Adgrv1 T C 13: 81,593,102 Y81C probably damaging Het
Alx3 A T 3: 107,600,706 Y177F probably damaging Het
C6 A G 15: 4,735,235 T138A probably benign Het
Cacna2d3 T C 14: 29,183,581 M410V probably benign Het
Celsr3 G A 9: 108,842,552 R2450H probably benign Het
Cnrip1 C T 11: 17,054,845 probably benign Het
Col6a5 A C 9: 105,864,669 D2350E probably damaging Het
Cyp4a12b A G 4: 115,434,970 I407V probably benign Het
Gpx4 A G 10: 80,056,189 I245V probably benign Het
H2-K1 A G 17: 33,999,525 I139T probably benign Het
Hmgcl A G 4: 135,959,987 K191R probably benign Het
Hpdl A G 4: 116,820,532 V244A possibly damaging Het
Hpse A G 5: 100,692,238 S338P probably damaging Het
Ifi203 T C 1: 173,935,080 K162R possibly damaging Het
Kit A G 5: 75,639,150 N514S probably damaging Het
Kmt2d G A 15: 98,844,149 probably benign Het
Limd1 T A 9: 123,480,374 S379R possibly damaging Het
Llph A G 10: 120,228,155 K59E probably benign Het
Lrrc7 T A 3: 158,163,956 M709L probably benign Het
Muc5ac A G 7: 141,798,501 S665G probably benign Het
Ncapd3 C T 9: 27,052,635 H524Y probably benign Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Olfr571 T C 7: 102,909,032 D269G probably benign Het
Papd5 G A 8: 88,243,329 E210K probably damaging Het
Pkd1l3 T C 8: 109,636,317 V1080A probably damaging Het
Plch1 A T 3: 63,699,523 H1007Q probably benign Het
Prr5 T C 15: 84,681,216 S3P probably damaging Het
Qtrt1 G A 9: 21,419,340 D279N probably damaging Het
Rundc1 G A 11: 101,434,201 A578T probably damaging Het
Shc4 A T 2: 125,723,331 V16E probably damaging Het
Sik3 A T 9: 46,194,822 L329F possibly damaging Het
Slc36a3 A G 11: 55,125,156 S391P possibly damaging Het
Smad1 C A 8: 79,339,770 R426L probably damaging Het
Thrap3 A T 4: 126,167,500 N820K possibly damaging Het
Tnrc6b T C 15: 80,923,640 S1598P probably damaging Het
Ttn T C 2: 76,714,824 I32645V probably damaging Het
Wisp1 A G 15: 66,919,288 Y313C probably damaging Het
Zfp266 A C 9: 20,499,481 Y467D probably damaging Het
Zfp526 T A 7: 25,226,203 M629K probably damaging Het
Zfp788 A T 7: 41,649,728 H596L probably damaging Het
Zhx3 A G 2: 160,780,448 W600R possibly damaging Het
Other mutations in Phtf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01443:Phtf2 APN 5 20782267 unclassified probably benign
IGL01789:Phtf2 APN 5 20794374 missense probably benign 0.00
IGL01816:Phtf2 APN 5 20803276 missense probably damaging 1.00
IGL02266:Phtf2 APN 5 20805799 missense probably damaging 1.00
IGL02295:Phtf2 APN 5 20807430 missense probably damaging 1.00
IGL03086:Phtf2 APN 5 20764275 missense probably damaging 0.99
IGL03179:Phtf2 APN 5 20782399 missense probably damaging 1.00
IGL03192:Phtf2 APN 5 20761719 missense probably damaging 0.99
IGL03256:Phtf2 APN 5 20803252 missense probably damaging 0.98
R0589:Phtf2 UTSW 5 20813251 nonsense probably null
R1732:Phtf2 UTSW 5 20789627 critical splice donor site probably null
R3151:Phtf2 UTSW 5 20765804 missense probably damaging 1.00
R3843:Phtf2 UTSW 5 20774022 missense probably damaging 1.00
R4080:Phtf2 UTSW 5 20813296 missense probably damaging 1.00
R4569:Phtf2 UTSW 5 20789595 intron probably benign
R4627:Phtf2 UTSW 5 20773740 missense probably damaging 1.00
R4901:Phtf2 UTSW 5 20805724 missense possibly damaging 0.73
R5131:Phtf2 UTSW 5 20774052 missense probably damaging 1.00
R5276:Phtf2 UTSW 5 20772197 missense probably benign 0.19
R5871:Phtf2 UTSW 5 20794401 missense probably benign 0.16
R5941:Phtf2 UTSW 5 20774073 missense probably damaging 0.98
R5964:Phtf2 UTSW 5 20775934 missense probably damaging 1.00
R6318:Phtf2 UTSW 5 20801941 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCTCCACCTACTGACTCAG -3'
(R):5'- AGCTCTCGCTGTTCAAGTTC -3'

Sequencing Primer
(F):5'- CCTACTGACTCAGGAACATGTGTG -3'
(R):5'- TCGCTGTTCAAGTTCCAGACAGG -3'
Posted On2015-03-25