Incidental Mutation 'R3791:Olfr571'
ID272531
Institutional Source Beutler Lab
Gene Symbol Olfr571
Ensembl Gene ENSMUSG00000043310
Gene Nameolfactory receptor 571
SynonymsMOR21-1, GA_x6K02T2PBJ9-5620890-5619922
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R3791 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location102905090-102917536 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102909032 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 269 (D269G)
Ref Sequence ENSEMBL: ENSMUSP00000148964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061738] [ENSMUST00000214160] [ENSMUST00000215773]
Predicted Effect probably benign
Transcript: ENSMUST00000061738
AA Change: D269G

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000062385
Gene: ENSMUSG00000043310
AA Change: D269G

DomainStartEndE-ValueType
Pfam:7tm_4 39 318 8.9e-91 PFAM
Pfam:7TM_GPCR_Srsx 43 177 3.1e-8 PFAM
Pfam:7tm_1 49 299 1.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214160
AA Change: D269G

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000215773
AA Change: D269G

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik AGGTGGTGGTGGTGGTGGTGGTGG AGGTGGTGGTGGTGGTGGTGG 6: 132,626,516 probably benign Het
A930009A15Rik A T 10: 115,578,289 probably benign Het
Adgrv1 T C 13: 81,593,102 Y81C probably damaging Het
Alx3 A T 3: 107,600,706 Y177F probably damaging Het
C6 A G 15: 4,735,235 T138A probably benign Het
Cacna2d3 T C 14: 29,183,581 M410V probably benign Het
Celsr3 G A 9: 108,842,552 R2450H probably benign Het
Cnrip1 C T 11: 17,054,845 probably benign Het
Col6a5 A C 9: 105,864,669 D2350E probably damaging Het
Cyp4a12b A G 4: 115,434,970 I407V probably benign Het
Gpx4 A G 10: 80,056,189 I245V probably benign Het
H2-K1 A G 17: 33,999,525 I139T probably benign Het
Hmgcl A G 4: 135,959,987 K191R probably benign Het
Hpdl A G 4: 116,820,532 V244A possibly damaging Het
Hpse A G 5: 100,692,238 S338P probably damaging Het
Ifi203 T C 1: 173,935,080 K162R possibly damaging Het
Kit A G 5: 75,639,150 N514S probably damaging Het
Kmt2d G A 15: 98,844,149 probably benign Het
Limd1 T A 9: 123,480,374 S379R possibly damaging Het
Llph A G 10: 120,228,155 K59E probably benign Het
Lrrc7 T A 3: 158,163,956 M709L probably benign Het
Muc5ac A G 7: 141,798,501 S665G probably benign Het
Ncapd3 C T 9: 27,052,635 H524Y probably benign Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Papd5 G A 8: 88,243,329 E210K probably damaging Het
Phtf2 T C 5: 20,782,298 E400G probably damaging Het
Pkd1l3 T C 8: 109,636,317 V1080A probably damaging Het
Plch1 A T 3: 63,699,523 H1007Q probably benign Het
Prr5 T C 15: 84,681,216 S3P probably damaging Het
Qtrt1 G A 9: 21,419,340 D279N probably damaging Het
Rundc1 G A 11: 101,434,201 A578T probably damaging Het
Shc4 A T 2: 125,723,331 V16E probably damaging Het
Sik3 A T 9: 46,194,822 L329F possibly damaging Het
Slc36a3 A G 11: 55,125,156 S391P possibly damaging Het
Smad1 C A 8: 79,339,770 R426L probably damaging Het
Thrap3 A T 4: 126,167,500 N820K possibly damaging Het
Tnrc6b T C 15: 80,923,640 S1598P probably damaging Het
Ttn T C 2: 76,714,824 I32645V probably damaging Het
Wisp1 A G 15: 66,919,288 Y313C probably damaging Het
Zfp266 A C 9: 20,499,481 Y467D probably damaging Het
Zfp526 T A 7: 25,226,203 M629K probably damaging Het
Zfp788 A T 7: 41,649,728 H596L probably damaging Het
Zhx3 A G 2: 160,780,448 W600R possibly damaging Het
Other mutations in Olfr571
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Olfr571 APN 7 102909272 missense probably damaging 1.00
IGL01457:Olfr571 APN 7 102909719 missense possibly damaging 0.74
IGL01962:Olfr571 APN 7 102909847 utr 5 prime probably benign
IGL02110:Olfr571 APN 7 102909195 missense probably benign 0.13
R0306:Olfr571 UTSW 7 102909803 missense probably benign
R0790:Olfr571 UTSW 7 102909636 missense probably benign 0.02
R6461:Olfr571 UTSW 7 102909028 missense possibly damaging 0.62
R6793:Olfr571 UTSW 7 102909728 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTTGGGAGTTCTTTACCACAAC -3'
(R):5'- ACAGCCTGGTTGTGGTACTG -3'

Sequencing Primer
(F):5'- GGAGTTCTTTACCACAACCATATAGG -3'
(R):5'- TGGTACTGTCAGCAATGGTACTAGAC -3'
Posted On2015-03-25