Incidental Mutation 'R3791:Smad1'
ID272533
Institutional Source Beutler Lab
Gene Symbol Smad1
Ensembl Gene ENSMUSG00000031681
Gene NameSMAD family member 1
SynonymsMadh1, Smad 1, Madr1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3791 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location79338395-79399518 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 79339770 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 426 (R426L)
Ref Sequence ENSEMBL: ENSMUSP00000071035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066091] [ENSMUST00000109885]
PDB Structure
Crystal Structure of SMAD1-MH1/DNA complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000066091
AA Change: R426L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071035
Gene: ENSMUSG00000031681
AA Change: R426L

DomainStartEndE-ValueType
DWA 25 134 6.94e-68 SMART
low complexity region 179 212 N/A INTRINSIC
low complexity region 219 233 N/A INTRINSIC
DWB 269 441 2.73e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109885
SMART Domains Protein: ENSMUSP00000105511
Gene: ENSMUSG00000031681

DomainStartEndE-ValueType
DWA 25 134 6.94e-68 SMART
low complexity region 179 212 N/A INTRINSIC
low complexity region 219 233 N/A INTRINSIC
DWB 269 425 3.92e-76 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210678
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the SMAD, a family of proteins similar to the gene products of the Drosophila gene 'mothers against decapentaplegic' (Mad) and the C. elegans gene Sma. SMAD proteins are signal transducers and transcriptional modulators that mediate multiple signaling pathways. This protein mediates the signals of the bone morphogenetic proteins (BMPs), which are involved in a range of biological activities including cell growth, apoptosis, morphogenesis, development and immune responses. In response to BMP ligands, this protein can be phosphorylated and activated by the BMP receptor kinase. The phosphorylated form of this protein forms a complex with SMAD4, which is important for its function in the transcription regulation. This protein is a target for SMAD-specific E3 ubiquitin ligases, such as SMURF1 and SMURF2, and undergoes ubiquitination and proteasome-mediated degradation. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired allantois formation resulting in the lack of a placenta, and die around embryonic day 9-10. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik AGGTGGTGGTGGTGGTGGTGGTGG AGGTGGTGGTGGTGGTGGTGG 6: 132,626,516 probably benign Het
A930009A15Rik A T 10: 115,578,289 probably benign Het
Adgrv1 T C 13: 81,593,102 Y81C probably damaging Het
Alx3 A T 3: 107,600,706 Y177F probably damaging Het
C6 A G 15: 4,735,235 T138A probably benign Het
Cacna2d3 T C 14: 29,183,581 M410V probably benign Het
Celsr3 G A 9: 108,842,552 R2450H probably benign Het
Cnrip1 C T 11: 17,054,845 probably benign Het
Col6a5 A C 9: 105,864,669 D2350E probably damaging Het
Cyp4a12b A G 4: 115,434,970 I407V probably benign Het
Gpx4 A G 10: 80,056,189 I245V probably benign Het
H2-K1 A G 17: 33,999,525 I139T probably benign Het
Hmgcl A G 4: 135,959,987 K191R probably benign Het
Hpdl A G 4: 116,820,532 V244A possibly damaging Het
Hpse A G 5: 100,692,238 S338P probably damaging Het
Ifi203 T C 1: 173,935,080 K162R possibly damaging Het
Kit A G 5: 75,639,150 N514S probably damaging Het
Kmt2d G A 15: 98,844,149 probably benign Het
Limd1 T A 9: 123,480,374 S379R possibly damaging Het
Llph A G 10: 120,228,155 K59E probably benign Het
Lrrc7 T A 3: 158,163,956 M709L probably benign Het
Muc5ac A G 7: 141,798,501 S665G probably benign Het
Ncapd3 C T 9: 27,052,635 H524Y probably benign Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Olfr571 T C 7: 102,909,032 D269G probably benign Het
Papd5 G A 8: 88,243,329 E210K probably damaging Het
Phtf2 T C 5: 20,782,298 E400G probably damaging Het
Pkd1l3 T C 8: 109,636,317 V1080A probably damaging Het
Plch1 A T 3: 63,699,523 H1007Q probably benign Het
Prr5 T C 15: 84,681,216 S3P probably damaging Het
Qtrt1 G A 9: 21,419,340 D279N probably damaging Het
Rundc1 G A 11: 101,434,201 A578T probably damaging Het
Shc4 A T 2: 125,723,331 V16E probably damaging Het
Sik3 A T 9: 46,194,822 L329F possibly damaging Het
Slc36a3 A G 11: 55,125,156 S391P possibly damaging Het
Thrap3 A T 4: 126,167,500 N820K possibly damaging Het
Tnrc6b T C 15: 80,923,640 S1598P probably damaging Het
Ttn T C 2: 76,714,824 I32645V probably damaging Het
Wisp1 A G 15: 66,919,288 Y313C probably damaging Het
Zfp266 A C 9: 20,499,481 Y467D probably damaging Het
Zfp526 T A 7: 25,226,203 M629K probably damaging Het
Zfp788 A T 7: 41,649,728 H596L probably damaging Het
Zhx3 A G 2: 160,780,448 W600R possibly damaging Het
Other mutations in Smad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Smad1 APN 8 79356469 missense probably damaging 0.97
IGL01792:Smad1 APN 8 79372123 missense probably damaging 1.00
R0395:Smad1 UTSW 8 79349782 missense probably benign 0.01
R0400:Smad1 UTSW 8 79371770 splice site probably benign
R0990:Smad1 UTSW 8 79343788 missense probably damaging 1.00
R1371:Smad1 UTSW 8 79349578 splice site probably benign
R1481:Smad1 UTSW 8 79343730 missense probably benign 0.20
R1661:Smad1 UTSW 8 79372029 missense probably damaging 1.00
R1665:Smad1 UTSW 8 79372029 missense probably damaging 1.00
R1797:Smad1 UTSW 8 79343844 missense probably damaging 1.00
R2879:Smad1 UTSW 8 79353455 splice site probably null
R3624:Smad1 UTSW 8 79339698 missense probably benign 0.31
R3815:Smad1 UTSW 8 79343730 missense probably benign 0.20
R3819:Smad1 UTSW 8 79343730 missense probably benign 0.20
R4887:Smad1 UTSW 8 79349752 missense probably damaging 1.00
R5438:Smad1 UTSW 8 79356320 missense probably benign 0.19
X0064:Smad1 UTSW 8 79353404 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGTACATGCAAGGCTCGATAG -3'
(R):5'- TGACAAAATGGGTCATCTGGGG -3'

Sequencing Primer
(F):5'- ACATGCAAGGCTCGATAGTTTGC -3'
(R):5'- TCCCAACATTTACCGACTACATATG -3'
Posted On2015-03-25