Incidental Mutation 'R3791:Nfix'
ID272534
Institutional Source Beutler Lab
Gene Symbol Nfix
Ensembl Gene ENSMUSG00000001911
Gene Namenuclear factor I/X
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.340) question?
Stock #R3791 (G1)
Quality Score101
Status Not validated
Chromosome8
Chromosomal Location84699876-84800344 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CAAAAA to CAAAA at 84716247 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076715] [ENSMUST00000099070] [ENSMUST00000109762] [ENSMUST00000109764] [ENSMUST00000126806]
Predicted Effect probably benign
Transcript: ENSMUST00000076715
SMART Domains Protein: ENSMUSP00000076005
Gene: ENSMUSG00000001911

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 4.1e-30 PFAM
DWA 67 175 1.86e-18 SMART
low complexity region 188 199 N/A INTRINSIC
Pfam:CTF_NFI 213 322 7.4e-32 PFAM
Pfam:CTF_NFI 313 396 3.8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099070
SMART Domains Protein: ENSMUSP00000096669
Gene: ENSMUSG00000001911

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 4.7e-30 PFAM
DWA 67 175 1.86e-18 SMART
low complexity region 188 199 N/A INTRINSIC
Pfam:CTF_NFI 213 437 2.7e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109762
SMART Domains Protein: ENSMUSP00000105384
Gene: ENSMUSG00000001911

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 1 38 1.1e-27 PFAM
DWA 59 167 1.86e-18 SMART
low complexity region 180 191 N/A INTRINSIC
Pfam:CTF_NFI 205 312 5.4e-32 PFAM
Pfam:CTF_NFI 305 387 3.6e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109764
SMART Domains Protein: ENSMUSP00000105386
Gene: ENSMUSG00000001911

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 1 38 1e-28 PFAM
DWA 59 167 1.86e-18 SMART
low complexity region 180 191 N/A INTRINSIC
Pfam:CTF_NFI 205 494 9.8e-137 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000126806
SMART Domains Protein: ENSMUSP00000115691
Gene: ENSMUSG00000001911

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 7.1e-31 PFAM
DWA 67 175 1.86e-18 SMART
low complexity region 188 199 N/A INTRINSIC
Pfam:CTF_NFI 213 488 1.5e-83 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132236
Meta Mutation Damage Score 0.6232 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor that binds the palindromic sequence 5'-TTGGCNNNNNGCCAA-3 in viral and cellular promoters. The encoded protein can also stimulate adenovirus replication in vitro. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a mutation in this gene display postnatal lethality, hydrocephalus, partial agenesis of the corpus callosum, deformation of the spine due to delayed vertebral body ossification, degeneration of intervertebral disks, decreased mineralization and impaired endochondral ossification. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik AGGTGGTGGTGGTGGTGGTGGTGG AGGTGGTGGTGGTGGTGGTGG 6: 132,626,516 probably benign Het
A930009A15Rik A T 10: 115,578,289 probably benign Het
Adgrv1 T C 13: 81,593,102 Y81C probably damaging Het
Alx3 A T 3: 107,600,706 Y177F probably damaging Het
C6 A G 15: 4,735,235 T138A probably benign Het
Cacna2d3 T C 14: 29,183,581 M410V probably benign Het
Celsr3 G A 9: 108,842,552 R2450H probably benign Het
Cnrip1 C T 11: 17,054,845 probably benign Het
Col6a5 A C 9: 105,864,669 D2350E probably damaging Het
Cyp4a12b A G 4: 115,434,970 I407V probably benign Het
Gpx4 A G 10: 80,056,189 I245V probably benign Het
H2-K1 A G 17: 33,999,525 I139T probably benign Het
Hmgcl A G 4: 135,959,987 K191R probably benign Het
Hpdl A G 4: 116,820,532 V244A possibly damaging Het
Hpse A G 5: 100,692,238 S338P probably damaging Het
Ifi203 T C 1: 173,935,080 K162R possibly damaging Het
Kit A G 5: 75,639,150 N514S probably damaging Het
Kmt2d G A 15: 98,844,149 probably benign Het
Limd1 T A 9: 123,480,374 S379R possibly damaging Het
Llph A G 10: 120,228,155 K59E probably benign Het
Lrrc7 T A 3: 158,163,956 M709L probably benign Het
Muc5ac A G 7: 141,798,501 S665G probably benign Het
Ncapd3 C T 9: 27,052,635 H524Y probably benign Het
Olfr571 T C 7: 102,909,032 D269G probably benign Het
Papd5 G A 8: 88,243,329 E210K probably damaging Het
Phtf2 T C 5: 20,782,298 E400G probably damaging Het
Pkd1l3 T C 8: 109,636,317 V1080A probably damaging Het
Plch1 A T 3: 63,699,523 H1007Q probably benign Het
Prr5 T C 15: 84,681,216 S3P probably damaging Het
Qtrt1 G A 9: 21,419,340 D279N probably damaging Het
Rundc1 G A 11: 101,434,201 A578T probably damaging Het
Shc4 A T 2: 125,723,331 V16E probably damaging Het
Sik3 A T 9: 46,194,822 L329F possibly damaging Het
Slc36a3 A G 11: 55,125,156 S391P possibly damaging Het
Smad1 C A 8: 79,339,770 R426L probably damaging Het
Thrap3 A T 4: 126,167,500 N820K possibly damaging Het
Tnrc6b T C 15: 80,923,640 S1598P probably damaging Het
Ttn T C 2: 76,714,824 I32645V probably damaging Het
Wisp1 A G 15: 66,919,288 Y313C probably damaging Het
Zfp266 A C 9: 20,499,481 Y467D probably damaging Het
Zfp526 T A 7: 25,226,203 M629K probably damaging Het
Zfp788 A T 7: 41,649,728 H596L probably damaging Het
Zhx3 A G 2: 160,780,448 W600R possibly damaging Het
Other mutations in Nfix
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Nfix APN 8 84726477 missense probably damaging 0.99
IGL01919:Nfix APN 8 84726474 missense probably damaging 1.00
IGL01950:Nfix APN 8 84713786 makesense probably null
IGL02862:Nfix APN 8 84713846 missense probably benign 0.07
R0142:Nfix UTSW 8 84721686 missense probably damaging 1.00
R0309:Nfix UTSW 8 84721774 missense probably damaging 1.00
R0600:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0622:Nfix UTSW 8 84726482 missense probably damaging 0.99
R0628:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0882:Nfix UTSW 8 84727925 missense probably damaging 1.00
R0893:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0973:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0973:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0974:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0975:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1014:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1015:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1162:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1241:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1381:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1513:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1521:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1618:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1865:Nfix UTSW 8 84772275 missense possibly damaging 0.73
R1912:Nfix UTSW 8 84721677 missense probably damaging 1.00
R1974:Nfix UTSW 8 84726526 missense probably damaging 1.00
R2208:Nfix UTSW 8 84716247 frame shift probably null
R2251:Nfix UTSW 8 84716170 missense probably benign 0.03
R2268:Nfix UTSW 8 84716247 frame shift probably null
R2270:Nfix UTSW 8 84716247 frame shift probably null
R2272:Nfix UTSW 8 84727175 missense probably damaging 1.00
R2346:Nfix UTSW 8 84716247 frame shift probably null
R2350:Nfix UTSW 8 84716247 frame shift probably null
R2963:Nfix UTSW 8 84716247 frame shift probably null
R2983:Nfix UTSW 8 84716247 frame shift probably null
R3008:Nfix UTSW 8 84716247 frame shift probably null
R3727:Nfix UTSW 8 84716247 frame shift probably null
R4163:Nfix UTSW 8 84716247 frame shift probably null
R4164:Nfix UTSW 8 84716247 frame shift probably null
R4201:Nfix UTSW 8 84716247 frame shift probably null
R4206:Nfix UTSW 8 84716247 frame shift probably null
R4609:Nfix UTSW 8 84726490 missense probably damaging 1.00
R4801:Nfix UTSW 8 84716247 frame shift probably null
R4802:Nfix UTSW 8 84716247 frame shift probably null
R4914:Nfix UTSW 8 84771829 missense probably benign 0.00
R4915:Nfix UTSW 8 84771829 missense probably benign 0.00
R4916:Nfix UTSW 8 84771829 missense probably benign 0.00
R4918:Nfix UTSW 8 84771829 missense probably benign 0.00
R5013:Nfix UTSW 8 84772084 missense possibly damaging 0.86
R5290:Nfix UTSW 8 84713777 nonsense probably null
R6418:Nfix UTSW 8 84727149 missense probably benign 0.01
R6554:Nfix UTSW 8 84727650 missense possibly damaging 0.93
R6786:Nfix UTSW 8 84727647 missense probably damaging 1.00
T0970:Nfix UTSW 8 84726483 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGCTGGCTGGAGTAACTGAG -3'
(R):5'- TGTGCCTAGAGGAAAGGACC -3'

Sequencing Primer
(F):5'- CCTCTCTTTGCAGTGGAGAC -3'
(R):5'- GAGGAAAGGACCCTCCCTC -3'
Posted On2015-03-25