Incidental Mutation 'R3791:Qtrt1'
ID272538
Institutional Source Beutler Lab
Gene Symbol Qtrt1
Ensembl Gene ENSMUSG00000002825
Gene Namequeuine tRNA-ribosyltransferase catalytic subunit 1
SynonymsTgt, tRNA-guanine transglycosylase, 2610028E17Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.430) question?
Stock #R3791 (G1)
Quality Score220
Status Not validated
Chromosome9
Chromosomal Location21411837-21420274 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 21419340 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 279 (D279N)
Ref Sequence ENSEMBL: ENSMUSP00000002902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002902] [ENSMUST00000214681] [ENSMUST00000216527]
Predicted Effect probably damaging
Transcript: ENSMUST00000002902
AA Change: D279N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000002902
Gene: ENSMUSG00000002825
AA Change: D279N

DomainStartEndE-ValueType
Pfam:TGT 142 376 1.4e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214101
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214128
Predicted Effect probably benign
Transcript: ENSMUST00000214681
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214900
Predicted Effect probably benign
Transcript: ENSMUST00000216277
Predicted Effect probably benign
Transcript: ENSMUST00000216527
Predicted Effect probably benign
Transcript: ENSMUST00000217060
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217188
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic subunit of tRNA-guanine transglycosylase. tRNA-guanine transglycosylase is a heterodimeric enzyme complex that plays a critical role in tRNA modification by synthesizing the 7-deazaguanosine queuosine, which is found in tRNAs that code for asparagine, aspartic acid, histidine and tyrosine. A pseudogene of this gene is located on the long arm of chromosome X. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice heterozygous or homozygous for a gene trap allele exhibit reduced phenylalanine conversion to tyrosine and reduced cell levels of queuosine-modified tRNA. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik AGGTGGTGGTGGTGGTGGTGGTGG AGGTGGTGGTGGTGGTGGTGG 6: 132,626,516 probably benign Het
A930009A15Rik A T 10: 115,578,289 probably benign Het
Adgrv1 T C 13: 81,593,102 Y81C probably damaging Het
Alx3 A T 3: 107,600,706 Y177F probably damaging Het
C6 A G 15: 4,735,235 T138A probably benign Het
Cacna2d3 T C 14: 29,183,581 M410V probably benign Het
Celsr3 G A 9: 108,842,552 R2450H probably benign Het
Cnrip1 C T 11: 17,054,845 probably benign Het
Col6a5 A C 9: 105,864,669 D2350E probably damaging Het
Cyp4a12b A G 4: 115,434,970 I407V probably benign Het
Gpx4 A G 10: 80,056,189 I245V probably benign Het
H2-K1 A G 17: 33,999,525 I139T probably benign Het
Hmgcl A G 4: 135,959,987 K191R probably benign Het
Hpdl A G 4: 116,820,532 V244A possibly damaging Het
Hpse A G 5: 100,692,238 S338P probably damaging Het
Ifi203 T C 1: 173,935,080 K162R possibly damaging Het
Kit A G 5: 75,639,150 N514S probably damaging Het
Kmt2d G A 15: 98,844,149 probably benign Het
Limd1 T A 9: 123,480,374 S379R possibly damaging Het
Llph A G 10: 120,228,155 K59E probably benign Het
Lrrc7 T A 3: 158,163,956 M709L probably benign Het
Muc5ac A G 7: 141,798,501 S665G probably benign Het
Ncapd3 C T 9: 27,052,635 H524Y probably benign Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Olfr571 T C 7: 102,909,032 D269G probably benign Het
Papd5 G A 8: 88,243,329 E210K probably damaging Het
Phtf2 T C 5: 20,782,298 E400G probably damaging Het
Pkd1l3 T C 8: 109,636,317 V1080A probably damaging Het
Plch1 A T 3: 63,699,523 H1007Q probably benign Het
Prr5 T C 15: 84,681,216 S3P probably damaging Het
Rundc1 G A 11: 101,434,201 A578T probably damaging Het
Shc4 A T 2: 125,723,331 V16E probably damaging Het
Sik3 A T 9: 46,194,822 L329F possibly damaging Het
Slc36a3 A G 11: 55,125,156 S391P possibly damaging Het
Smad1 C A 8: 79,339,770 R426L probably damaging Het
Thrap3 A T 4: 126,167,500 N820K possibly damaging Het
Tnrc6b T C 15: 80,923,640 S1598P probably damaging Het
Ttn T C 2: 76,714,824 I32645V probably damaging Het
Wisp1 A G 15: 66,919,288 Y313C probably damaging Het
Zfp266 A C 9: 20,499,481 Y467D probably damaging Het
Zfp526 T A 7: 25,226,203 M629K probably damaging Het
Zfp788 A T 7: 41,649,728 H596L probably damaging Het
Zhx3 A G 2: 160,780,448 W600R possibly damaging Het
Other mutations in Qtrt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Qtrt1 APN 9 21419549 critical splice donor site probably null
IGL02048:Qtrt1 APN 9 21417355 missense probably damaging 1.00
IGL02217:Qtrt1 APN 9 21417389 critical splice donor site probably null
IGL02299:Qtrt1 APN 9 21411949 missense probably benign 0.06
R0496:Qtrt1 UTSW 9 21419548 missense probably benign 0.09
R0625:Qtrt1 UTSW 9 21418288 missense probably benign 0.43
R1173:Qtrt1 UTSW 9 21412486 missense probably benign 0.05
R1174:Qtrt1 UTSW 9 21412486 missense probably benign 0.05
R1250:Qtrt1 UTSW 9 21419548 missense probably benign 0.09
R1563:Qtrt1 UTSW 9 21419311 missense probably benign 0.44
R4997:Qtrt1 UTSW 9 21417358 missense probably benign 0.00
R6057:Qtrt1 UTSW 9 21412003 missense probably damaging 1.00
R6762:Qtrt1 UTSW 9 21412082 missense probably damaging 1.00
Predicted Primers
Posted On2015-03-25