Incidental Mutation 'R3791:Celsr3'
ID272542
Institutional Source Beutler Lab
Gene Symbol Celsr3
Ensembl Gene ENSMUSG00000023473
Gene Namecadherin, EGF LAG seven-pass G-type receptor 3
SynonymsFmi1, flamingo
Accession Numbers

Genbank: NM_080437; MGI: 1858236 

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3791 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location108826320-108852969 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 108842552 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 2450 (R2450H)
Ref Sequence ENSEMBL: ENSMUSP00000150759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024238] [ENSMUST00000194079] [ENSMUST00000213524]
Predicted Effect probably benign
Transcript: ENSMUST00000024238
AA Change: R2443H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024238
Gene: ENSMUSG00000023473
AA Change: R2443H

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 264 293 N/A INTRINSIC
CA 338 422 2.25e-27 SMART
CA 446 534 5.05e-30 SMART
CA 558 640 7.6e-25 SMART
CA 664 745 7.36e-32 SMART
CA 769 847 5.95e-18 SMART
CA 871 950 5.25e-28 SMART
CA 974 1056 2.67e-29 SMART
CA 1080 1158 1.18e-21 SMART
CA 1186 1262 3.2e-1 SMART
low complexity region 1328 1335 N/A INTRINSIC
low complexity region 1350 1360 N/A INTRINSIC
EGF 1369 1424 1.02e-2 SMART
EGF 1429 1464 3.23e0 SMART
EGF 1467 1503 8.78e-2 SMART
LamG 1524 1691 2.27e-35 SMART
EGF 1714 1747 4.22e-4 SMART
LamG 1774 1913 9.02e-21 SMART
EGF 1938 1971 2.43e-4 SMART
EGF 1973 2009 1.3e-4 SMART
EGF_Lam 2066 2111 5.08e-7 SMART
HormR 2114 2176 3.42e-21 SMART
Pfam:GAIN 2188 2441 1.1e-57 PFAM
GPS 2467 2520 7.92e-20 SMART
Pfam:7tm_2 2527 2758 1.5e-56 PFAM
low complexity region 2813 2829 N/A INTRINSIC
low complexity region 2882 2906 N/A INTRINSIC
low complexity region 3058 3072 N/A INTRINSIC
low complexity region 3149 3189 N/A INTRINSIC
low complexity region 3239 3261 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175326
Predicted Effect probably benign
Transcript: ENSMUST00000194079
SMART Domains Protein: ENSMUSP00000141789
Gene: ENSMUSG00000023473

DomainStartEndE-ValueType
Pfam:7tm_2 1 185 6.9e-45 PFAM
low complexity region 240 256 N/A INTRINSIC
low complexity region 309 333 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195857
Predicted Effect probably benign
Transcript: ENSMUST00000213524
AA Change: R2450H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.034 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the flamingo subfamily, which is included in the cadherin superfamily. The flamingo cadherins consist of nonclassic-type cadherins that do not interact with catenins. They are plasma membrane proteins containing seven epidermal growth factor-like repeats, nine cadherin domains and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic feature of their subfamily. The encoded protein may be involved in the regulation of contact-dependent neurite growth and may play a role in tumor formation. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality, abnormal neurvous system development, and abnormal respiratory system development. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik AGGTGGTGGTGGTGGTGGTGGTGG AGGTGGTGGTGGTGGTGGTGG 6: 132,626,516 probably benign Het
A930009A15Rik A T 10: 115,578,289 probably benign Het
Adgrv1 T C 13: 81,593,102 Y81C probably damaging Het
Alx3 A T 3: 107,600,706 Y177F probably damaging Het
C6 A G 15: 4,735,235 T138A probably benign Het
Cacna2d3 T C 14: 29,183,581 M410V probably benign Het
Cnrip1 C T 11: 17,054,845 probably benign Het
Col6a5 A C 9: 105,864,669 D2350E probably damaging Het
Cyp4a12b A G 4: 115,434,970 I407V probably benign Het
Gpx4 A G 10: 80,056,189 I245V probably benign Het
H2-K1 A G 17: 33,999,525 I139T probably benign Het
Hmgcl A G 4: 135,959,987 K191R probably benign Het
Hpdl A G 4: 116,820,532 V244A possibly damaging Het
Hpse A G 5: 100,692,238 S338P probably damaging Het
Ifi203 T C 1: 173,935,080 K162R possibly damaging Het
Kit A G 5: 75,639,150 N514S probably damaging Het
Kmt2d G A 15: 98,844,149 probably benign Het
Limd1 T A 9: 123,480,374 S379R possibly damaging Het
Llph A G 10: 120,228,155 K59E probably benign Het
Lrrc7 T A 3: 158,163,956 M709L probably benign Het
Muc5ac A G 7: 141,798,501 S665G probably benign Het
Ncapd3 C T 9: 27,052,635 H524Y probably benign Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Olfr571 T C 7: 102,909,032 D269G probably benign Het
Papd5 G A 8: 88,243,329 E210K probably damaging Het
Phtf2 T C 5: 20,782,298 E400G probably damaging Het
Pkd1l3 T C 8: 109,636,317 V1080A probably damaging Het
Plch1 A T 3: 63,699,523 H1007Q probably benign Het
Prr5 T C 15: 84,681,216 S3P probably damaging Het
Qtrt1 G A 9: 21,419,340 D279N probably damaging Het
Rundc1 G A 11: 101,434,201 A578T probably damaging Het
Shc4 A T 2: 125,723,331 V16E probably damaging Het
Sik3 A T 9: 46,194,822 L329F possibly damaging Het
Slc36a3 A G 11: 55,125,156 S391P possibly damaging Het
Smad1 C A 8: 79,339,770 R426L probably damaging Het
Thrap3 A T 4: 126,167,500 N820K possibly damaging Het
Tnrc6b T C 15: 80,923,640 S1598P probably damaging Het
Ttn T C 2: 76,714,824 I32645V probably damaging Het
Wisp1 A G 15: 66,919,288 Y313C probably damaging Het
Zfp266 A C 9: 20,499,481 Y467D probably damaging Het
Zfp526 T A 7: 25,226,203 M629K probably damaging Het
Zfp788 A T 7: 41,649,728 H596L probably damaging Het
Zhx3 A G 2: 160,780,448 W600R possibly damaging Het
Other mutations in Celsr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Celsr3 APN 9 108848925 missense probably damaging 1.00
IGL00536:Celsr3 APN 9 108829192 missense probably benign 0.33
IGL00552:Celsr3 APN 9 108841263 missense possibly damaging 0.88
IGL00801:Celsr3 APN 9 108842576 missense probably benign
IGL01420:Celsr3 APN 9 108841190 critical splice acceptor site probably null
IGL01541:Celsr3 APN 9 108831708 missense probably damaging 1.00
IGL01619:Celsr3 APN 9 108834557 missense probably damaging 1.00
IGL01619:Celsr3 APN 9 108837404 missense probably benign 0.00
IGL01631:Celsr3 APN 9 108837404 missense probably benign 0.00
IGL01777:Celsr3 APN 9 108835942 missense probably benign 0.08
IGL01938:Celsr3 APN 9 108828415 missense probably benign 0.34
IGL02135:Celsr3 APN 9 108827556 missense probably benign 0.11
IGL02231:Celsr3 APN 9 108842510 missense probably damaging 1.00
IGL02234:Celsr3 APN 9 108829960 missense probably benign
IGL02392:Celsr3 APN 9 108834721
IGL02416:Celsr3 APN 9 108832119 missense probably damaging 1.00
IGL02421:Celsr3 APN 9 108840463 missense probably damaging 1.00
IGL02455:Celsr3 APN 9 108842893 missense probably benign 0.15
IGL02798:Celsr3 APN 9 108843575 missense probably damaging 1.00
IGL02939:Celsr3 APN 9 108849453 missense probably damaging 1.00
IGL02947:Celsr3 APN 9 108845935 missense probably benign 0.12
IGL02986:Celsr3 APN 9 108841255 unclassified probably null
IGL03089:Celsr3 APN 9 108826607 missense probably benign 0.04
IGL03162:Celsr3 APN 9 108842558 missense probably damaging 1.00
IGL03267:Celsr3 APN 9 108836525
F6893:Celsr3 UTSW 9 108835067 missense probably benign 0.00
R0110:Celsr3 UTSW 9 108827005 missense possibly damaging 0.62
R0243:Celsr3 UTSW 9 108843724 splice site probably benign
R0382:Celsr3 UTSW 9 108829218 missense probably damaging 1.00
R0482:Celsr3 UTSW 9 108829073 nonsense probably null
R0510:Celsr3 UTSW 9 108827005 missense possibly damaging 0.62
R0630:Celsr3 UTSW 9 108827692 missense probably damaging 0.98
R0656:Celsr3 UTSW 9 108834655 missense possibly damaging 0.89
R0764:Celsr3 UTSW 9 108827818 missense probably damaging 1.00
R0883:Celsr3 UTSW 9 108842633 missense probably damaging 1.00
R0924:Celsr3 UTSW 9 108846025 missense possibly damaging 0.78
R1015:Celsr3 UTSW 9 108833176 missense probably benign 0.17
R1321:Celsr3 UTSW 9 108835870 missense probably damaging 1.00
R1423:Celsr3 UTSW 9 108826905 missense probably benign 0.00
R1497:Celsr3 UTSW 9 108848865 missense probably benign 0.14
R1520:Celsr3 UTSW 9 108848658 missense probably damaging 1.00
R1534:Celsr3 UTSW 9 108848884 missense probably damaging 0.99
R1569:Celsr3 UTSW 9 108829068 missense probably damaging 1.00
R1657:Celsr3 UTSW 9 108842952 nonsense probably null
R1753:Celsr3 UTSW 9 108831857 missense probably damaging 0.99
R1764:Celsr3 UTSW 9 108828958 missense probably damaging 1.00
R1801:Celsr3 UTSW 9 108834626 missense possibly damaging 0.88
R1838:Celsr3 UTSW 9 108829906 missense probably benign
R1839:Celsr3 UTSW 9 108829906 missense probably benign
R1874:Celsr3 UTSW 9 108835838 missense probably benign
R1875:Celsr3 UTSW 9 108835838 missense probably benign
R1953:Celsr3 UTSW 9 108843182 missense probably benign 0.19
R1960:Celsr3 UTSW 9 108845817 missense probably benign
R2113:Celsr3 UTSW 9 108838470 missense probably damaging 1.00
R2290:Celsr3 UTSW 9 108843224 missense probably damaging 1.00
R2369:Celsr3 UTSW 9 108842552 missense probably benign
R2373:Celsr3 UTSW 9 108842552 missense probably benign
R2374:Celsr3 UTSW 9 108842552 missense probably benign
R2375:Celsr3 UTSW 9 108842552 missense probably benign
R2844:Celsr3 UTSW 9 108829308 missense probably damaging 1.00
R2968:Celsr3 UTSW 9 108832191 missense probably damaging 1.00
R3103:Celsr3 UTSW 9 108837139 missense probably benign 0.31
R3159:Celsr3 UTSW 9 108827710 missense possibly damaging 0.94
R4194:Celsr3 UTSW 9 108843302 critical splice donor site probably null
R4329:Celsr3 UTSW 9 108846049 missense probably benign 0.00
R4365:Celsr3 UTSW 9 108829847 missense possibly damaging 0.47
R4419:Celsr3 UTSW 9 108843244 missense possibly damaging 0.84
R4484:Celsr3 UTSW 9 108846063 critical splice donor site probably null
R4582:Celsr3 UTSW 9 108845723 missense probably damaging 1.00
R4681:Celsr3 UTSW 9 108827754 missense possibly damaging 0.58
R4729:Celsr3 UTSW 9 108847652 missense probably benign 0.05
R4881:Celsr3 UTSW 9 108843941 missense probably damaging 1.00
R4893:Celsr3 UTSW 9 108849421 missense probably damaging 1.00
R5183:Celsr3 UTSW 9 108837560 missense probably damaging 0.99
R5207:Celsr3 UTSW 9 108832759 missense probably benign 0.01
R5290:Celsr3 UTSW 9 108843158 missense probably benign 0.01
R5327:Celsr3 UTSW 9 108842708 intron probably benign
R5345:Celsr3 UTSW 9 108832124 missense probably damaging 1.00
R5358:Celsr3 UTSW 9 108832025 missense possibly damaging 0.96
R5396:Celsr3 UTSW 9 108828582 missense probably damaging 1.00
R5414:Celsr3 UTSW 9 108840042 missense possibly damaging 0.88
R5452:Celsr3 UTSW 9 108844034 missense possibly damaging 0.68
R5467:Celsr3 UTSW 9 108828637 missense probably damaging 1.00
R5479:Celsr3 UTSW 9 108844544 critical splice donor site probably null
R5629:Celsr3 UTSW 9 108849067 missense probably benign 0.41
R5637:Celsr3 UTSW 9 108837133 missense probably damaging 1.00
R5652:Celsr3 UTSW 9 108838472 missense probably benign 0.03
R5739:Celsr3 UTSW 9 108827158 missense probably benign
R5785:Celsr3 UTSW 9 108827797 missense probably damaging 1.00
R5877:Celsr3 UTSW 9 108845727 missense probably damaging 0.98
R5961:Celsr3 UTSW 9 108831794 missense probably damaging 1.00
R6046:Celsr3 UTSW 9 108837151 missense probably benign 0.01
R6176:Celsr3 UTSW 9 108828355 missense probably damaging 1.00
R6291:Celsr3 UTSW 9 108828842 missense probably damaging 1.00
R6468:Celsr3 UTSW 9 108835790 missense probably benign 0.08
R6481:Celsr3 UTSW 9 108837084 missense possibly damaging 0.92
R6547:Celsr3 UTSW 9 108829128 missense probably damaging 1.00
R6763:Celsr3 UTSW 9 108827350 missense probably damaging 1.00
R6870:Celsr3 UTSW 9 108829191 missense probably benign 0.02
R6977:Celsr3 UTSW 9 108827715 missense probably benign
X0018:Celsr3 UTSW 9 108827778 missense possibly damaging 0.65
X0018:Celsr3 UTSW 9 108840412 missense probably benign 0.01
X0026:Celsr3 UTSW 9 108828930 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGTGTTCTTAGAAACAACCTGTAC -3'
(R):5'- CCACATGGGCCTAATTGCAC -3'

Sequencing Primer
(F):5'- AACAACCTGTACTGTGCGGGTATC -3'
(R):5'- CCTAATTGCACAGTGGCATAG -3'
Posted On2015-03-25