Mutagenetix > Incidental Mutation

Incidental Mutation 'R3791:Gpx4'

272544

Institutional Source

Beutler Lab

Gene Symbol

Gpx4

Ensembl Gene

ENSMUSG00000075706

Gene Name

glutathione peroxidase 4

Synonyms

snGPx, sperm nuclei glutathione peroxidase, mtPHGPx, PHGPx, phospholipid hydroperoxide glutathione peroxidase

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3791 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

79883000-79892273 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 79892023 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 245 (I245V)

Ref Sequence

ENSEMBL: ENSMUSP00000094863 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042771] [ENSMUST00000097227] [ENSMUST00000105372] [ENSMUST00000183037] [ENSMUST00000218630] [ENSMUST00000219260]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000042771

SMART Domains

Protein: ENSMUSP00000041635
Gene: ENSMUSG00000035673

Domain	Start	End	E-Value	Type
low complexity region	96	112	N/A	INTRINSIC
low complexity region	177	189	N/A	INTRINSIC
Pfam:AAA_34	209	500	8.2e-135	PFAM
Pfam:ResIII	239	419	7.7e-8	PFAM
low complexity region	611	631	N/A	INTRINSIC
Pfam:Helicase_C_4	726	1004	7.5e-120	PFAM
low complexity region	1263	1283	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000097227
AA Change: I245V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000094863
Gene: ENSMUSG00000075706
AA Change: I245V

Domain	Start	End	E-Value	Type
low complexity region	2	55	N/A	INTRINSIC
Pfam:GSHPx	97	204	6e-47	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000105372
AA Change: I189V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000101011
Gene: ENSMUSG00000075706
AA Change: I189V

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:GSHPx	41	148	1.3e-46	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136081

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144698

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145703

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154095

Predicted Effect

probably benign
Transcript: ENSMUST00000183037
AA Change: I149V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000138186
Gene: ENSMUSG00000075706
AA Change: I149V

Domain	Start	End	E-Value	Type
Pfam:GSHPx	1	108	3.6e-47	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000218630

Predicted Effect

probably benign
Transcript: ENSMUST00000219260

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 93.9%

Validation Efficiency

MGI Phenotype

FUNCTION: The protein encoded by this gene belongs to the glutathione peroxidase family, members of which catalyze the reduction of hydrogen peroxide, organic hydroperoxides and lipid hydroperoxides, and thereby protect cells against oxidative damage. Several isozymes of this gene family exist in vertebrates, which vary in cellular location and substrate specificity. This isozyme has a high preference for lipid hydroperoxides and protects cells against membrane lipid peroxidation and cell death. It is also required for normal sperm development; thus, it has been identified as a 'moonlighting' protein because of its ability to serve dual functions as a peroxidase, as well as a structural protein in mature spermatozoa. Disruption of this gene in mouse spermatocytes is associated with male infertility. This isozyme is also a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Alternatively spliced transcript variants have been found for this gene. Two pseudogenes of this gene have been defined on chromosomes 10 and 17. [provided by RefSeq, Oct 2016]
PHENOTYPE: Gastrulation is impaired and homozygous mutant embryos consequently die during early embryonic development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630073D07Rik	AGGTGGTGGTGGTGGTGGTGGTGG	AGGTGGTGGTGGTGGTGGTGG	6: 132,603,479 (GRCm39)		probably benign	Het
A930009A15Rik	A	T	10: 115,414,194 (GRCm39)		probably benign	Het
Adgrv1	T	C	13: 81,741,221 (GRCm39)	Y81C	probably damaging	Het
Alx3	A	T	3: 107,508,022 (GRCm39)	Y177F	probably damaging	Het
C6	A	G	15: 4,764,717 (GRCm39)	T138A	probably benign	Het
Cacna2d3	T	C	14: 28,905,538 (GRCm39)	M410V	probably benign	Het
Ccn4	A	G	15: 66,791,137 (GRCm39)	Y313C	probably damaging	Het
Celsr3	G	A	9: 108,719,751 (GRCm39)	R2450H	probably benign	Het
Cnrip1	C	T	11: 17,004,845 (GRCm39)		probably benign	Het
Col6a5	A	C	9: 105,741,868 (GRCm39)	D2350E	probably damaging	Het
Cyp4a12b	A	G	4: 115,292,167 (GRCm39)	I407V	probably benign	Het
H2-K2	A	G	17: 34,218,499 (GRCm39)	I139T	probably benign	Het
Hmgcl	A	G	4: 135,687,298 (GRCm39)	K191R	probably benign	Het
Hpdl	A	G	4: 116,677,729 (GRCm39)	V244A	possibly damaging	Het
Hpse	A	G	5: 100,840,104 (GRCm39)	S338P	probably damaging	Het
Ifi203	T	C	1: 173,762,646 (GRCm39)	K162R	possibly damaging	Het
Kit	A	G	5: 75,799,810 (GRCm39)	N514S	probably damaging	Het
Kmt2d	G	A	15: 98,742,030 (GRCm39)		probably benign	Het
Limd1	T	A	9: 123,309,439 (GRCm39)	S379R	possibly damaging	Het
Llph	A	G	10: 120,064,060 (GRCm39)	K59E	probably benign	Het
Lrrc7	T	A	3: 157,869,593 (GRCm39)	M709L	probably benign	Het
Muc5ac	A	G	7: 141,352,238 (GRCm39)	S665G	probably benign	Het
Ncapd3	C	T	9: 26,963,931 (GRCm39)	H524Y	probably benign	Het
Nfix	CAAAAA	CAAAA	8: 85,442,876 (GRCm39)		probably null	Het
Or51s1	T	C	7: 102,558,239 (GRCm39)	D269G	probably benign	Het
Phtf2	T	C	5: 20,987,296 (GRCm39)	E400G	probably damaging	Het
Pkd1l3	T	C	8: 110,362,949 (GRCm39)	V1080A	probably damaging	Het
Plch1	A	T	3: 63,606,944 (GRCm39)	H1007Q	probably benign	Het
Prr5	T	C	15: 84,565,417 (GRCm39)	S3P	probably damaging	Het
Qtrt1	G	A	9: 21,330,636 (GRCm39)	D279N	probably damaging	Het
Rundc1	G	A	11: 101,325,027 (GRCm39)	A578T	probably damaging	Het
Shc4	A	T	2: 125,565,251 (GRCm39)	V16E	probably damaging	Het
Sik3	A	T	9: 46,106,120 (GRCm39)	L329F	possibly damaging	Het
Slc36a3	A	G	11: 55,015,982 (GRCm39)	S391P	possibly damaging	Het
Smad1	C	A	8: 80,066,399 (GRCm39)	R426L	probably damaging	Het
Tent4b	G	A	8: 88,969,957 (GRCm39)	E210K	probably damaging	Het
Thrap3	A	T	4: 126,061,293 (GRCm39)	N820K	possibly damaging	Het
Tnrc6b	T	C	15: 80,807,841 (GRCm39)	S1598P	probably damaging	Het
Ttn	T	C	2: 76,545,168 (GRCm39)	I32645V	probably damaging	Het
Zfp266	A	C	9: 20,410,777 (GRCm39)	Y467D	probably damaging	Het
Zfp526	T	A	7: 24,925,628 (GRCm39)	M629K	probably damaging	Het
Zfp788	A	T	7: 41,299,152 (GRCm39)	H596L	probably damaging	Het
Zhx3	A	G	2: 160,622,368 (GRCm39)	W600R	possibly damaging	Het

Other mutations in Gpx4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0230:Gpx4	UTSW	10	79,890,838 (GRCm39)	missense	probably benign	0.15
R0494:Gpx4	UTSW	10	79,892,011 (GRCm39)	unclassified	probably benign
R1848:Gpx4	UTSW	10	79,891,870 (GRCm39)	unclassified	probably benign
R7570:Gpx4	UTSW	10	79,890,875 (GRCm39)	missense	probably damaging	1.00
R9783:Gpx4	UTSW	10	79,890,851 (GRCm39)	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- AACACATGTTCCTCTGTCTTACAG -3'
(R):5'- TTTTATTCCCACAAGGCAGCC -3'

Sequencing Primer
(F):5'- GTTTCTCATTGATAAGAACGGCTGC -3'
(R):5'- ACAGGCCTCTGGACCTTC -3'

Posted On

2015-03-25