Incidental Mutation 'R3791:Wisp1'
ID272555
Institutional Source Beutler Lab
Gene Symbol Wisp1
Ensembl Gene ENSMUSG00000005124
Gene NameWNT1 inducible signaling pathway protein 1
SynonymsCCN4, Elm1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R3791 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location66891320-66923201 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66919288 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 313 (Y313C)
Ref Sequence ENSEMBL: ENSMUSP00000005255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005255] [ENSMUST00000118823] [ENSMUST00000147079]
Predicted Effect probably damaging
Transcript: ENSMUST00000005255
AA Change: Y313C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005255
Gene: ENSMUSG00000005124
AA Change: Y313C

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IB 49 117 6.39e-13 SMART
VWC 123 185 5.63e-13 SMART
TSP1 217 260 4.34e-5 SMART
CT 278 347 1.42e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118823
SMART Domains Protein: ENSMUSP00000113144
Gene: ENSMUSG00000005124

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IB 49 117 3.19e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133863
Predicted Effect probably benign
Transcript: ENSMUST00000147079
SMART Domains Protein: ENSMUSP00000117402
Gene: ENSMUSG00000005124

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230535
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WNT1 inducible signaling pathway (WISP) protein subfamily, which belongs to the connective tissue growth factor (CTGF) family. WNT1 is a member of a family of cysteine-rich, glycosylated signaling proteins that mediate diverse developmental processes. The CTGF family members are characterized by four conserved cysteine-rich domains: insulin-like growth factor-binding domain, von Willebrand factor type C module, thrombospondin domain and C-terminal cystine knot-like domain. This gene may be downstream in the WNT1 signaling pathway that is relevant to malignant transformation. It is expressed at a high level in fibroblast cells, and overexpressed in colon tumors. The encoded protein binds to decorin and biglycan, two members of a family of small leucine-rich proteoglycans present in the extracellular matrix of connective tissue, and possibly prevents the inhibitory activity of decorin and biglycan in tumor cell proliferation. It also attenuates p53-mediated apoptosis in response to DNA damage through activation of the Akt kinase. It is 83% identical to the mouse protein at the amino acid level. Multiple alternatively spliced transcript variants have been identified. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit impaired motor coordination during inverted screen testing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik AGGTGGTGGTGGTGGTGGTGGTGG AGGTGGTGGTGGTGGTGGTGG 6: 132,626,516 probably benign Het
A930009A15Rik A T 10: 115,578,289 probably benign Het
Adgrv1 T C 13: 81,593,102 Y81C probably damaging Het
Alx3 A T 3: 107,600,706 Y177F probably damaging Het
C6 A G 15: 4,735,235 T138A probably benign Het
Cacna2d3 T C 14: 29,183,581 M410V probably benign Het
Celsr3 G A 9: 108,842,552 R2450H probably benign Het
Cnrip1 C T 11: 17,054,845 probably benign Het
Col6a5 A C 9: 105,864,669 D2350E probably damaging Het
Cyp4a12b A G 4: 115,434,970 I407V probably benign Het
Gpx4 A G 10: 80,056,189 I245V probably benign Het
H2-K1 A G 17: 33,999,525 I139T probably benign Het
Hmgcl A G 4: 135,959,987 K191R probably benign Het
Hpdl A G 4: 116,820,532 V244A possibly damaging Het
Hpse A G 5: 100,692,238 S338P probably damaging Het
Ifi203 T C 1: 173,935,080 K162R possibly damaging Het
Kit A G 5: 75,639,150 N514S probably damaging Het
Kmt2d G A 15: 98,844,149 probably benign Het
Limd1 T A 9: 123,480,374 S379R possibly damaging Het
Llph A G 10: 120,228,155 K59E probably benign Het
Lrrc7 T A 3: 158,163,956 M709L probably benign Het
Muc5ac A G 7: 141,798,501 S665G probably benign Het
Ncapd3 C T 9: 27,052,635 H524Y probably benign Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Olfr571 T C 7: 102,909,032 D269G probably benign Het
Papd5 G A 8: 88,243,329 E210K probably damaging Het
Phtf2 T C 5: 20,782,298 E400G probably damaging Het
Pkd1l3 T C 8: 109,636,317 V1080A probably damaging Het
Plch1 A T 3: 63,699,523 H1007Q probably benign Het
Prr5 T C 15: 84,681,216 S3P probably damaging Het
Qtrt1 G A 9: 21,419,340 D279N probably damaging Het
Rundc1 G A 11: 101,434,201 A578T probably damaging Het
Shc4 A T 2: 125,723,331 V16E probably damaging Het
Sik3 A T 9: 46,194,822 L329F possibly damaging Het
Slc36a3 A G 11: 55,125,156 S391P possibly damaging Het
Smad1 C A 8: 79,339,770 R426L probably damaging Het
Thrap3 A T 4: 126,167,500 N820K possibly damaging Het
Tnrc6b T C 15: 80,923,640 S1598P probably damaging Het
Ttn T C 2: 76,714,824 I32645V probably damaging Het
Zfp266 A C 9: 20,499,481 Y467D probably damaging Het
Zfp526 T A 7: 25,226,203 M629K probably damaging Het
Zfp788 A T 7: 41,649,728 H596L probably damaging Het
Zhx3 A G 2: 160,780,448 W600R possibly damaging Het
Other mutations in Wisp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03051:Wisp1 APN 15 66906550 nonsense probably null
IGL03057:Wisp1 APN 15 66891640 splice site probably benign
R0029:Wisp1 UTSW 15 66912864 missense probably damaging 1.00
R0125:Wisp1 UTSW 15 66917345 missense possibly damaging 0.82
R0164:Wisp1 UTSW 15 66919210 missense probably damaging 1.00
R0164:Wisp1 UTSW 15 66919210 missense probably damaging 1.00
R0470:Wisp1 UTSW 15 66917378 missense probably benign 0.13
R0847:Wisp1 UTSW 15 66919275 missense probably damaging 1.00
R1463:Wisp1 UTSW 15 66919271 missense possibly damaging 0.52
R1623:Wisp1 UTSW 15 66891599 missense possibly damaging 0.46
R1785:Wisp1 UTSW 15 66906489 missense probably damaging 1.00
R1786:Wisp1 UTSW 15 66906489 missense probably damaging 1.00
R2027:Wisp1 UTSW 15 66917409 missense possibly damaging 0.50
R2104:Wisp1 UTSW 15 66919327 missense probably benign 0.11
R2440:Wisp1 UTSW 15 66912857 missense possibly damaging 0.71
R4748:Wisp1 UTSW 15 66906640 nonsense probably null
R5317:Wisp1 UTSW 15 66917282 missense probably benign
R6960:Wisp1 UTSW 15 66919198 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCATGGTGGCTATACATCACC -3'
(R):5'- TGAAGTCCTGGACCACAAAGG -3'

Sequencing Primer
(F):5'- TGGTGGCTATACATCACCAGTAC -3'
(R):5'- GCAGCATGGAACTTTACCCTGAG -3'
Posted On2015-03-25