Incidental Mutation 'R3791:H2-K1'
ID272561
Institutional Source Beutler Lab
Gene Symbol H2-K1
Ensembl Gene ENSMUSG00000061232
Gene Namehistocompatibility 2, K1, K region
SynonymsH-2K
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R3791 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location33996017-34000333 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33999525 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 139 (I139T)
Ref Sequence ENSEMBL: ENSMUSP00000133847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025181] [ENSMUST00000087189] [ENSMUST00000172912] [ENSMUST00000173075]
Predicted Effect probably benign
Transcript: ENSMUST00000025181
AA Change: I119T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000025181
Gene: ENSMUSG00000061232
AA Change: I119T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 22 200 1.4e-95 PFAM
IGc1 219 290 9.98e-22 SMART
transmembrane domain 306 328 N/A INTRINSIC
Pfam:MHC_I_C 335 359 2.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000087189
SMART Domains Protein: ENSMUSP00000084436
Gene: ENSMUSG00000061232

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
IGc1 37 108 9.98e-22 SMART
low complexity region 124 143 N/A INTRINSIC
Pfam:MHC_I_C 152 177 5.9e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172782
Predicted Effect probably benign
Transcript: ENSMUST00000172912
AA Change: I119T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000134004
Gene: ENSMUSG00000061232
AA Change: I119T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 22 200 6.7e-97 PFAM
IGc1 219 290 9.98e-22 SMART
transmembrane domain 306 328 N/A INTRINSIC
Pfam:MHC_I_C 334 359 9.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173075
AA Change: I139T

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000133847
Gene: ENSMUSG00000061232
AA Change: I139T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 42 220 3.7e-97 PFAM
Pfam:C1-set 229 289 4.2e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173317
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173543
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173602
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions of this gene display T-cell abnormalities and abnormal susceptibility to various viral infections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik AGGTGGTGGTGGTGGTGGTGGTGG AGGTGGTGGTGGTGGTGGTGG 6: 132,626,516 probably benign Het
A930009A15Rik A T 10: 115,578,289 probably benign Het
Adgrv1 T C 13: 81,593,102 Y81C probably damaging Het
Alx3 A T 3: 107,600,706 Y177F probably damaging Het
C6 A G 15: 4,735,235 T138A probably benign Het
Cacna2d3 T C 14: 29,183,581 M410V probably benign Het
Celsr3 G A 9: 108,842,552 R2450H probably benign Het
Cnrip1 C T 11: 17,054,845 probably benign Het
Col6a5 A C 9: 105,864,669 D2350E probably damaging Het
Cyp4a12b A G 4: 115,434,970 I407V probably benign Het
Gpx4 A G 10: 80,056,189 I245V probably benign Het
Hmgcl A G 4: 135,959,987 K191R probably benign Het
Hpdl A G 4: 116,820,532 V244A possibly damaging Het
Hpse A G 5: 100,692,238 S338P probably damaging Het
Ifi203 T C 1: 173,935,080 K162R possibly damaging Het
Kit A G 5: 75,639,150 N514S probably damaging Het
Kmt2d G A 15: 98,844,149 probably benign Het
Limd1 T A 9: 123,480,374 S379R possibly damaging Het
Llph A G 10: 120,228,155 K59E probably benign Het
Lrrc7 T A 3: 158,163,956 M709L probably benign Het
Muc5ac A G 7: 141,798,501 S665G probably benign Het
Ncapd3 C T 9: 27,052,635 H524Y probably benign Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Olfr571 T C 7: 102,909,032 D269G probably benign Het
Papd5 G A 8: 88,243,329 E210K probably damaging Het
Phtf2 T C 5: 20,782,298 E400G probably damaging Het
Pkd1l3 T C 8: 109,636,317 V1080A probably damaging Het
Plch1 A T 3: 63,699,523 H1007Q probably benign Het
Prr5 T C 15: 84,681,216 S3P probably damaging Het
Qtrt1 G A 9: 21,419,340 D279N probably damaging Het
Rundc1 G A 11: 101,434,201 A578T probably damaging Het
Shc4 A T 2: 125,723,331 V16E probably damaging Het
Sik3 A T 9: 46,194,822 L329F possibly damaging Het
Slc36a3 A G 11: 55,125,156 S391P possibly damaging Het
Smad1 C A 8: 79,339,770 R426L probably damaging Het
Thrap3 A T 4: 126,167,500 N820K possibly damaging Het
Tnrc6b T C 15: 80,923,640 S1598P probably damaging Het
Ttn T C 2: 76,714,824 I32645V probably damaging Het
Wisp1 A G 15: 66,919,288 Y313C probably damaging Het
Zfp266 A C 9: 20,499,481 Y467D probably damaging Het
Zfp526 T A 7: 25,226,203 M629K probably damaging Het
Zfp788 A T 7: 41,649,728 H596L probably damaging Het
Zhx3 A G 2: 160,780,448 W600R possibly damaging Het
Other mutations in H2-K1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02189:H2-K1 APN 17 33999492 missense probably damaging 1.00
FR4548:H2-K1 UTSW 17 33997042 unclassified probably benign
FR4976:H2-K1 UTSW 17 33997042 unclassified probably benign
R0254:H2-K1 UTSW 17 33996665 unclassified probably benign
R0520:H2-K1 UTSW 17 33997416 missense probably damaging 1.00
R0540:H2-K1 UTSW 17 33999500 missense probably damaging 1.00
R0607:H2-K1 UTSW 17 33999500 missense probably damaging 1.00
R1282:H2-K1 UTSW 17 33999447 missense probably damaging 1.00
R1785:H2-K1 UTSW 17 33997348 nonsense probably null
R2307:H2-K1 UTSW 17 33997139 missense probably benign 0.26
R3847:H2-K1 UTSW 17 33997329 missense probably damaging 1.00
R4008:H2-K1 UTSW 17 33999551 splice site probably benign
R4324:H2-K1 UTSW 17 34000040 missense possibly damaging 0.76
R4470:H2-K1 UTSW 17 34000061 missense probably benign 0.20
R4543:H2-K1 UTSW 17 33999558 splice site probably null
R4858:H2-K1 UTSW 17 33997324 missense probably benign 0.05
R4921:H2-K1 UTSW 17 33997076 missense possibly damaging 0.65
R5254:H2-K1 UTSW 17 33997462 missense probably damaging 1.00
R5269:H2-K1 UTSW 17 33997015 unclassified probably benign
R6058:H2-K1 UTSW 17 33999330 missense probably benign 0.02
R6058:H2-K1 UTSW 17 33999331 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAGTCTCTCTGCTTCACCAG -3'
(R):5'- GGCTACTACAACCAGAGCAAGG -3'

Sequencing Primer
(F):5'- AGCCTGCTCCCACTTGTG -3'
(R):5'- CAAGGGCGGTGAGTGACC -3'
Posted On2015-03-25