Incidental Mutation 'R3792:Stag3'
ID272581
Institutional Source Beutler Lab
Gene Symbol Stag3
Ensembl Gene ENSMUSG00000036928
Gene Namestromal antigen 3
SynonymsSA-2, stromalin 3
Accession Numbers

Ncbi RefSeq: NM_016964.2; MGI:1355311

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3792 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location138280240-138312393 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 138298349 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 490 (K490E)
Ref Sequence ENSEMBL: ENSMUSP00000125523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048028] [ENSMUST00000162245]
Predicted Effect probably benign
Transcript: ENSMUST00000048028
AA Change: K490E

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000040945
Gene: ENSMUSG00000036928
AA Change: K490E

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
Pfam:STAG 188 301 3.1e-38 PFAM
low complexity region 633 653 N/A INTRINSIC
low complexity region 1099 1114 N/A INTRINSIC
low complexity region 1141 1151 N/A INTRINSIC
low complexity region 1190 1208 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159483
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161113
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161615
Predicted Effect probably benign
Transcript: ENSMUST00000162245
AA Change: K490E

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000125523
Gene: ENSMUSG00000036928
AA Change: K490E

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
Pfam:STAG 185 304 4e-50 PFAM
low complexity region 633 653 N/A INTRINSIC
low complexity region 1099 1114 N/A INTRINSIC
low complexity region 1141 1151 N/A INTRINSIC
low complexity region 1190 1208 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype Strain: 5287255
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is expressed in the nucleus and is a subunit of the cohesin complex which regulates the cohesion of sister chromatids during cell division. A mutation in this gene is associated with premature ovarian failure. Alternate splicing results in multiple transcript variants encoding distinct isoforms. This gene has multiple pseudogenes. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit azoospermia and lack oocytes. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(2) Gene trapped(1) Transgenic(1)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930595M18Rik A G X: 81,420,817 V428A probably benign Het
Aanat T C 11: 116,596,231 L88P probably damaging Het
Arhgap5 A T 12: 52,519,888 N1214I probably benign Het
BC034090 A T 1: 155,241,797 S192T probably damaging Het
Bco1 G A 8: 117,130,676 V461I possibly damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Cubn G A 2: 13,427,914 R1199C probably damaging Het
Dcaf12l1 T C X: 44,788,436 N495S possibly damaging Het
Dopey2 C A 16: 93,771,846 Q1599K possibly damaging Het
Dyrk1a C A 16: 94,685,074 L427I probably benign Het
Esp16 T C 17: 39,537,848 I11T possibly damaging Het
Esyt3 A T 9: 99,315,281 F832Y possibly damaging Het
F8 A T X: 75,285,365 probably null Het
Fam135a T C 1: 24,028,311 Y259C probably benign Het
Fbxo38 T C 18: 62,533,462 probably null Het
Fbxo43 T C 15: 36,162,859 I67M probably benign Het
Gcfc2 G T 6: 81,930,767 C154F probably benign Het
Gm21731 G T 13: 120,240,931 V88F probably damaging Het
Hipk2 C T 6: 38,698,556 R1029H probably damaging Het
Ilk G A 7: 105,742,087 W73* probably null Het
Ism1 T C 2: 139,740,253 S162P probably damaging Het
Itpkb T A 1: 180,333,173 L288Q possibly damaging Het
Itpr2 C A 6: 146,415,354 K306N probably damaging Het
Kdm2a C T 19: 4,324,512 E864K possibly damaging Het
Kdm4b G A 17: 56,355,944 V172M probably damaging Het
Kyat3 A T 3: 142,737,844 K406M probably null Het
Lipe T A 7: 25,397,620 K299N possibly damaging Het
Lrrc2 T A 9: 110,966,517 C123* probably null Het
Mptx2 T A 1: 173,274,673 I150F probably damaging Het
Mroh2b G T 15: 4,923,620 W612L probably damaging Het
Mucl2 T C 15: 103,898,426 T27A possibly damaging Het
Nfx1 T A 4: 41,004,357 C709* probably null Het
Olfr164 A G 16: 19,285,946 S266P possibly damaging Het
Olfr624 A T 7: 103,670,146 I295N probably damaging Het
Oprm1 T C 10: 6,839,544 S390P probably benign Het
Pcdhb14 T C 18: 37,449,662 L607P probably damaging Het
Rap1gds1 A T 3: 138,965,960 I133N probably damaging Het
Rasl10a T C 11: 5,059,461 L83S probably damaging Het
Satb2 C T 1: 56,845,620 V382M probably damaging Het
Sh3gl1 T C 17: 56,018,949 K160R probably damaging Het
Sirt4 T C 5: 115,480,292 D241G probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Spef2 A G 15: 9,704,536 I454T probably damaging Het
Tctn3 T C 19: 40,611,711 K95R probably benign Het
Tdgf1 C T 9: 110,943,190 R46Q probably benign Het
Trp53bp1 T C 2: 121,200,329 I1784V probably damaging Het
Ttc21a A T 9: 119,954,165 E511V probably damaging Het
Ttn A G 2: 76,711,888 F25258L probably damaging Het
Ttn A C 2: 76,808,946 C13828G probably damaging Het
Vmn1r210 T A 13: 22,827,403 M238L probably damaging Het
Vmn1r38 A G 6: 66,776,907 I75T probably benign Het
Vmn2r84 T A 10: 130,385,800 *850C probably null Het
Vwa7 T C 17: 35,025,159 probably null Het
Zfp128 T A 7: 12,884,732 D52E probably damaging Het
Zfp618 T C 4: 63,115,491 probably benign Het
Zkscan2 T A 7: 123,485,002 E633V possibly damaging Het
Other mutations in Stag3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Stag3 APN 5 138299138 missense probably damaging 1.00
IGL00336:Stag3 APN 5 138297659 missense probably benign 0.42
IGL00514:Stag3 APN 5 138300135 missense probably damaging 1.00
IGL00961:Stag3 APN 5 138298349 missense probably benign 0.01
IGL01923:Stag3 APN 5 138289230 missense probably damaging 1.00
IGL02252:Stag3 APN 5 138302548 missense probably damaging 1.00
IGL02424:Stag3 APN 5 138281985 nonsense probably null
IGL02424:Stag3 APN 5 138291366 missense probably damaging 1.00
IGL02869:Stag3 APN 5 138282693 missense probably damaging 0.96
thor UTSW 5 138301036 critical splice donor site probably null
R0016:Stag3 UTSW 5 138291381 missense possibly damaging 0.50
R0038:Stag3 UTSW 5 138301036 critical splice donor site probably null
R0038:Stag3 UTSW 5 138301036 critical splice donor site probably null
R0046:Stag3 UTSW 5 138283023 splice site probably benign
R0046:Stag3 UTSW 5 138283023 splice site probably benign
R1455:Stag3 UTSW 5 138311735 missense probably benign 0.00
R1512:Stag3 UTSW 5 138297985 missense probably benign 0.32
R1530:Stag3 UTSW 5 138297412 missense probably damaging 0.99
R1608:Stag3 UTSW 5 138298639 intron probably null
R1736:Stag3 UTSW 5 138304509 splice site probably benign
R1969:Stag3 UTSW 5 138300138 missense probably damaging 0.99
R2034:Stag3 UTSW 5 138298001 missense possibly damaging 0.82
R2214:Stag3 UTSW 5 138301266 missense possibly damaging 0.92
R2281:Stag3 UTSW 5 138298284 missense probably damaging 1.00
R2411:Stag3 UTSW 5 138283028 splice site probably benign
R3887:Stag3 UTSW 5 138298839 missense probably damaging 0.99
R4255:Stag3 UTSW 5 138290881 missense probably damaging 0.98
R4777:Stag3 UTSW 5 138309199 unclassified probably benign
R4842:Stag3 UTSW 5 138309365 intron probably null
R4854:Stag3 UTSW 5 138296694 splice site probably null
R5045:Stag3 UTSW 5 138304478 missense probably damaging 1.00
R5631:Stag3 UTSW 5 138295877 missense probably damaging 0.96
R5729:Stag3 UTSW 5 138290223 missense possibly damaging 0.76
R5894:Stag3 UTSW 5 138298838 missense probably damaging 0.99
R6004:Stag3 UTSW 5 138289206 missense probably damaging 1.00
R6172:Stag3 UTSW 5 138299843 missense probably benign 0.41
R6503:Stag3 UTSW 5 138304420 missense probably damaging 0.96
R6545:Stag3 UTSW 5 138298352 missense possibly damaging 0.84
R6736:Stag3 UTSW 5 138301499 missense probably damaging 0.98
R6861:Stag3 UTSW 5 138304707 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TGCTATGGCCTCTTCTGCAG -3'
(R):5'- GCTGTGAAAGAAGGTTCGC -3'

Sequencing Primer
(F):5'- GTGTATGTATTTGTCACACTGTCC -3'
(R):5'- GAAGGTTCGCAGTAAGTTATCCACC -3'
Posted On2015-03-25