Incidental Mutation 'R3792:Olfr624'
ID272589
Institutional Source Beutler Lab
Gene Symbol Olfr624
Ensembl Gene ENSMUSG00000045780
Gene Nameolfactory receptor 624
SynonymsMOR4-2P, GA_x6K02T2PBJ9-6394126-6393197
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R3792 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location103665461-103671191 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103670146 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 295 (I295N)
Ref Sequence ENSEMBL: ENSMUSP00000049938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062144]
Predicted Effect probably damaging
Transcript: ENSMUST00000062144
AA Change: I295N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049938
Gene: ENSMUSG00000045780
AA Change: I295N

DomainStartEndE-ValueType
Pfam:7tm_4 27 306 3.3e-138 PFAM
Pfam:7tm_1 37 288 1.8e-19 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930595M18Rik A G X: 81,420,817 V428A probably benign Het
Aanat T C 11: 116,596,231 L88P probably damaging Het
Arhgap5 A T 12: 52,519,888 N1214I probably benign Het
BC034090 A T 1: 155,241,797 S192T probably damaging Het
Bco1 G A 8: 117,130,676 V461I possibly damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Cubn G A 2: 13,427,914 R1199C probably damaging Het
Dcaf12l1 T C X: 44,788,436 N495S possibly damaging Het
Dopey2 C A 16: 93,771,846 Q1599K possibly damaging Het
Dyrk1a C A 16: 94,685,074 L427I probably benign Het
Esp16 T C 17: 39,537,848 I11T possibly damaging Het
Esyt3 A T 9: 99,315,281 F832Y possibly damaging Het
F8 A T X: 75,285,365 probably null Het
Fam135a T C 1: 24,028,311 Y259C probably benign Het
Fbxo38 T C 18: 62,533,462 probably null Het
Fbxo43 T C 15: 36,162,859 I67M probably benign Het
Gcfc2 G T 6: 81,930,767 C154F probably benign Het
Gm21731 G T 13: 120,240,931 V88F probably damaging Het
Hipk2 C T 6: 38,698,556 R1029H probably damaging Het
Ilk G A 7: 105,742,087 W73* probably null Het
Ism1 T C 2: 139,740,253 S162P probably damaging Het
Itpkb T A 1: 180,333,173 L288Q possibly damaging Het
Itpr2 C A 6: 146,415,354 K306N probably damaging Het
Kdm2a C T 19: 4,324,512 E864K possibly damaging Het
Kdm4b G A 17: 56,355,944 V172M probably damaging Het
Kyat3 A T 3: 142,737,844 K406M probably null Het
Lipe T A 7: 25,397,620 K299N possibly damaging Het
Lrrc2 T A 9: 110,966,517 C123* probably null Het
Mptx2 T A 1: 173,274,673 I150F probably damaging Het
Mroh2b G T 15: 4,923,620 W612L probably damaging Het
Mucl2 T C 15: 103,898,426 T27A possibly damaging Het
Nfx1 T A 4: 41,004,357 C709* probably null Het
Olfr164 A G 16: 19,285,946 S266P possibly damaging Het
Oprm1 T C 10: 6,839,544 S390P probably benign Het
Pcdhb14 T C 18: 37,449,662 L607P probably damaging Het
Rap1gds1 A T 3: 138,965,960 I133N probably damaging Het
Rasl10a T C 11: 5,059,461 L83S probably damaging Het
Satb2 C T 1: 56,845,620 V382M probably damaging Het
Sh3gl1 T C 17: 56,018,949 K160R probably damaging Het
Sirt4 T C 5: 115,480,292 D241G probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Spef2 A G 15: 9,704,536 I454T probably damaging Het
Stag3 A G 5: 138,298,349 K490E probably benign Het
Tctn3 T C 19: 40,611,711 K95R probably benign Het
Tdgf1 C T 9: 110,943,190 R46Q probably benign Het
Trp53bp1 T C 2: 121,200,329 I1784V probably damaging Het
Ttc21a A T 9: 119,954,165 E511V probably damaging Het
Ttn A G 2: 76,711,888 F25258L probably damaging Het
Ttn A C 2: 76,808,946 C13828G probably damaging Het
Vmn1r210 T A 13: 22,827,403 M238L probably damaging Het
Vmn1r38 A G 6: 66,776,907 I75T probably benign Het
Vmn2r84 T A 10: 130,385,800 *850C probably null Het
Vwa7 T C 17: 35,025,159 probably null Het
Zfp128 T A 7: 12,884,732 D52E probably damaging Het
Zfp618 T C 4: 63,115,491 probably benign Het
Zkscan2 T A 7: 123,485,002 E633V possibly damaging Het
Other mutations in Olfr624
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02419:Olfr624 APN 7 103670475 nonsense probably null
IGL02536:Olfr624 APN 7 103670957 missense possibly damaging 0.78
IGL02684:Olfr624 APN 7 103670384 missense probably benign 0.06
FR4548:Olfr624 UTSW 7 103670960 small insertion probably benign
FR4548:Olfr624 UTSW 7 103670967 nonsense probably null
FR4976:Olfr624 UTSW 7 103670966 small insertion probably benign
R0295:Olfr624 UTSW 7 103670311 missense probably damaging 1.00
R0518:Olfr624 UTSW 7 103670489 missense possibly damaging 0.56
R0521:Olfr624 UTSW 7 103670489 missense possibly damaging 0.56
R1352:Olfr624 UTSW 7 103670311 missense probably damaging 1.00
R1779:Olfr624 UTSW 7 103670638 missense probably benign 0.15
R1878:Olfr624 UTSW 7 103670182 missense probably damaging 1.00
R1965:Olfr624 UTSW 7 103670896 missense probably damaging 1.00
R2162:Olfr624 UTSW 7 103670872 missense possibly damaging 0.95
R2316:Olfr624 UTSW 7 103670467 missense probably damaging 0.97
R3848:Olfr624 UTSW 7 103670701 missense probably damaging 0.99
R4120:Olfr624 UTSW 7 103671014 missense probably benign
R4183:Olfr624 UTSW 7 103670971 missense possibly damaging 0.87
R4853:Olfr624 UTSW 7 103670803 missense probably damaging 1.00
R6351:Olfr624 UTSW 7 103670956 missense possibly damaging 0.50
X0026:Olfr624 UTSW 7 103670395 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCCACTCATACTTGTCAGCAC -3'
(R):5'- ATCGATTGCATCCAGGGAGG -3'

Sequencing Primer
(F):5'- TTCATGATGGCTGTGGTAAAAAG -3'
(R):5'- GTCTTTGCAAACATGTGTATCTCAC -3'
Posted On2015-03-25