Incidental Mutation 'R3792:Lrrc2'
ID272595
Institutional Source Beutler Lab
Gene Symbol Lrrc2
Ensembl Gene ENSMUSG00000032495
Gene Nameleucine rich repeat containing 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3792 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location110951545-110984066 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 110966517 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 123 (C123*)
Ref Sequence ENSEMBL: ENSMUSP00000142360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035076] [ENSMUST00000196834]
Predicted Effect probably null
Transcript: ENSMUST00000035076
AA Change: C189*
SMART Domains Protein: ENSMUSP00000035076
Gene: ENSMUSG00000032495
AA Change: C189*

DomainStartEndE-ValueType
Blast:LRR 143 165 5e-7 BLAST
LRR_TYP 166 189 4.87e-4 SMART
LRR 236 258 1.41e1 SMART
LRR 259 282 2.27e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196598
Predicted Effect probably null
Transcript: ENSMUST00000196834
AA Change: C123*
SMART Domains Protein: ENSMUSP00000142360
Gene: ENSMUSG00000032495
AA Change: C123*

DomainStartEndE-ValueType
Blast:LRR 77 99 2e-7 BLAST
LRR_TYP 100 123 2e-6 SMART
LRR 147 170 6.2e-1 SMART
Meta Mutation Damage Score 0.594 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the leucine-rich repeat-containing family of proteins, which function in diverse biological pathways. This family member may possibly be a nuclear protein. Similarity to the RAS suppressor protein, as well as expression down-regulation observed in tumor cells, suggests that it may function as a tumor suppressor. The gene is located in the chromosome 3 common eliminated region 1 (C3CER1), a 1.4 Mb region that is commonly deleted in diverse tumors. A related pseudogene has been identified on chromosome 2. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930595M18Rik A G X: 81,420,817 V428A probably benign Het
Aanat T C 11: 116,596,231 L88P probably damaging Het
Arhgap5 A T 12: 52,519,888 N1214I probably benign Het
BC034090 A T 1: 155,241,797 S192T probably damaging Het
Bco1 G A 8: 117,130,676 V461I possibly damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Cubn G A 2: 13,427,914 R1199C probably damaging Het
Dcaf12l1 T C X: 44,788,436 N495S possibly damaging Het
Dopey2 C A 16: 93,771,846 Q1599K possibly damaging Het
Dyrk1a C A 16: 94,685,074 L427I probably benign Het
Esp16 T C 17: 39,537,848 I11T possibly damaging Het
Esyt3 A T 9: 99,315,281 F832Y possibly damaging Het
F8 A T X: 75,285,365 probably null Het
Fam135a T C 1: 24,028,311 Y259C probably benign Het
Fbxo38 T C 18: 62,533,462 probably null Het
Fbxo43 T C 15: 36,162,859 I67M probably benign Het
Gcfc2 G T 6: 81,930,767 C154F probably benign Het
Gm21731 G T 13: 120,240,931 V88F probably damaging Het
Hipk2 C T 6: 38,698,556 R1029H probably damaging Het
Ilk G A 7: 105,742,087 W73* probably null Het
Ism1 T C 2: 139,740,253 S162P probably damaging Het
Itpkb T A 1: 180,333,173 L288Q possibly damaging Het
Itpr2 C A 6: 146,415,354 K306N probably damaging Het
Kdm2a C T 19: 4,324,512 E864K possibly damaging Het
Kdm4b G A 17: 56,355,944 V172M probably damaging Het
Kyat3 A T 3: 142,737,844 K406M probably null Het
Lipe T A 7: 25,397,620 K299N possibly damaging Het
Mptx2 T A 1: 173,274,673 I150F probably damaging Het
Mroh2b G T 15: 4,923,620 W612L probably damaging Het
Mucl2 T C 15: 103,898,426 T27A possibly damaging Het
Nfx1 T A 4: 41,004,357 C709* probably null Het
Olfr164 A G 16: 19,285,946 S266P possibly damaging Het
Olfr624 A T 7: 103,670,146 I295N probably damaging Het
Oprm1 T C 10: 6,839,544 S390P probably benign Het
Pcdhb14 T C 18: 37,449,662 L607P probably damaging Het
Rap1gds1 A T 3: 138,965,960 I133N probably damaging Het
Rasl10a T C 11: 5,059,461 L83S probably damaging Het
Satb2 C T 1: 56,845,620 V382M probably damaging Het
Sh3gl1 T C 17: 56,018,949 K160R probably damaging Het
Sirt4 T C 5: 115,480,292 D241G probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Spef2 A G 15: 9,704,536 I454T probably damaging Het
Stag3 A G 5: 138,298,349 K490E probably benign Het
Tctn3 T C 19: 40,611,711 K95R probably benign Het
Tdgf1 C T 9: 110,943,190 R46Q probably benign Het
Trp53bp1 T C 2: 121,200,329 I1784V probably damaging Het
Ttc21a A T 9: 119,954,165 E511V probably damaging Het
Ttn A G 2: 76,711,888 F25258L probably damaging Het
Ttn A C 2: 76,808,946 C13828G probably damaging Het
Vmn1r210 T A 13: 22,827,403 M238L probably damaging Het
Vmn1r38 A G 6: 66,776,907 I75T probably benign Het
Vmn2r84 T A 10: 130,385,800 *850C probably null Het
Vwa7 T C 17: 35,025,159 probably null Het
Zfp128 T A 7: 12,884,732 D52E probably damaging Het
Zfp618 T C 4: 63,115,491 probably benign Het
Zkscan2 T A 7: 123,485,002 E633V possibly damaging Het
Other mutations in Lrrc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01796:Lrrc2 APN 9 110980818 unclassified probably null
IGL02243:Lrrc2 APN 9 110970057 missense probably damaging 1.00
IGL02715:Lrrc2 APN 9 110970114 missense probably damaging 1.00
IGL02793:Lrrc2 APN 9 110979627 critical splice donor site probably null
IGL02958:Lrrc2 APN 9 110962673 critical splice donor site probably null
PIT4362001:Lrrc2 UTSW 9 110962540 missense possibly damaging 0.91
R0255:Lrrc2 UTSW 9 110980898 missense possibly damaging 0.87
R0472:Lrrc2 UTSW 9 110962617 missense probably benign 0.00
R0909:Lrrc2 UTSW 9 110962673 critical splice donor site probably null
R1575:Lrrc2 UTSW 9 110979487 missense probably benign 0.07
R1619:Lrrc2 UTSW 9 110960973 missense probably benign 0.00
R1669:Lrrc2 UTSW 9 110981650 missense probably damaging 0.99
R1778:Lrrc2 UTSW 9 110980840 missense probably benign
R1914:Lrrc2 UTSW 9 110980939 missense probably damaging 1.00
R2165:Lrrc2 UTSW 9 110979577 missense possibly damaging 0.78
R3793:Lrrc2 UTSW 9 110966517 nonsense probably null
R4499:Lrrc2 UTSW 9 110962645 missense probably benign 0.11
R4683:Lrrc2 UTSW 9 110962546 missense possibly damaging 0.95
R4693:Lrrc2 UTSW 9 110970093 missense probably damaging 1.00
R4723:Lrrc2 UTSW 9 110970160 critical splice donor site probably null
R5033:Lrrc2 UTSW 9 110980919 missense probably damaging 0.98
R5935:Lrrc2 UTSW 9 110966561 missense probably benign 0.17
R6269:Lrrc2 UTSW 9 110980949 missense probably damaging 1.00
R6645:Lrrc2 UTSW 9 110970107 missense probably damaging 1.00
R6855:Lrrc2 UTSW 9 110953182 intron probably null
Predicted Primers PCR Primer
(F):5'- AAAGCTTTCTCCCCTGAGATTTGTC -3'
(R):5'- TTGCTTGGCAACTCACATTTGC -3'

Sequencing Primer
(F):5'- GTCTGAGCCTAAAGGTCTATGCCAC -3'
(R):5'- CATGTGAAGCTTAAGAACAAACTAGC -3'
Posted On2015-03-25