Incidental Mutation 'R3792:Aanat'
ID272600
Institutional Source Beutler Lab
Gene Symbol Aanat
Ensembl Gene ENSMUSG00000020804
Gene Namearylalkylamine N-acetyltransferase
SynonymsNat-2, SNAT, Nat4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R3792 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location116586432-116597680 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116596231 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 88 (L88P)
Ref Sequence ENSEMBL: ENSMUSP00000122895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021160] [ENSMUST00000103028] [ENSMUST00000103029] [ENSMUST00000123507] [ENSMUST00000153476]
Predicted Effect probably damaging
Transcript: ENSMUST00000021160
AA Change: L88P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021160
Gene: ENSMUSG00000020804
AA Change: L88P

DomainStartEndE-ValueType
PDB:1KUY|A 3 104 1e-50 PDB
SCOP:d1cjwa_ 28 103 4e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103028
SMART Domains Protein: ENSMUSP00000099317
Gene: ENSMUSG00000020806

DomainStartEndE-ValueType
Pfam:Rhomboid_SP 98 306 1.8e-98 PFAM
transmembrane domain 376 398 N/A INTRINSIC
Pfam:Rhomboid 619 763 4.6e-31 PFAM
transmembrane domain 775 797 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103029
SMART Domains Protein: ENSMUSP00000099318
Gene: ENSMUSG00000020806

DomainStartEndE-ValueType
Pfam:Rhomboid_SP 98 304 4.7e-97 PFAM
transmembrane domain 376 398 N/A INTRINSIC
Pfam:Rhomboid 619 763 8.1e-31 PFAM
transmembrane domain 775 797 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123507
SMART Domains Protein: ENSMUSP00000115999
Gene: ENSMUSG00000020804

DomainStartEndE-ValueType
PDB:1IB1|H 3 53 6e-16 PDB
SCOP:d1cjwa_ 28 59 1e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142978
Predicted Effect probably damaging
Transcript: ENSMUST00000153476
AA Change: L88P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122895
Gene: ENSMUSG00000020804
AA Change: L88P

DomainStartEndE-ValueType
Pfam:Acetyltransf_1 82 172 4.1e-14 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the acetyltransferase superfamily. It is the penultimate enzyme in melatonin synthesis and controls the night/day rhythm in melatonin production in the vertebrate pineal gland. Melatonin is essential for the function of the circadian clock that influences activity and sleep. This enzyme is regulated by cAMP-dependent phosphorylation that promotes its interaction with 14-3-3 proteins and thus protects the enzyme against proteasomal degradation. This gene may contribute to numerous genetic diseases such as delayed sleep phase syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mutations in this gene result in abnormal melatonin production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930595M18Rik A G X: 81,420,817 V428A probably benign Het
Arhgap5 A T 12: 52,519,888 N1214I probably benign Het
BC034090 A T 1: 155,241,797 S192T probably damaging Het
Bco1 G A 8: 117,130,676 V461I possibly damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Cubn G A 2: 13,427,914 R1199C probably damaging Het
Dcaf12l1 T C X: 44,788,436 N495S possibly damaging Het
Dopey2 C A 16: 93,771,846 Q1599K possibly damaging Het
Dyrk1a C A 16: 94,685,074 L427I probably benign Het
Esp16 T C 17: 39,537,848 I11T possibly damaging Het
Esyt3 A T 9: 99,315,281 F832Y possibly damaging Het
F8 A T X: 75,285,365 probably null Het
Fam135a T C 1: 24,028,311 Y259C probably benign Het
Fbxo38 T C 18: 62,533,462 probably null Het
Fbxo43 T C 15: 36,162,859 I67M probably benign Het
Gcfc2 G T 6: 81,930,767 C154F probably benign Het
Gm21731 G T 13: 120,240,931 V88F probably damaging Het
Hipk2 C T 6: 38,698,556 R1029H probably damaging Het
Ilk G A 7: 105,742,087 W73* probably null Het
Ism1 T C 2: 139,740,253 S162P probably damaging Het
Itpkb T A 1: 180,333,173 L288Q possibly damaging Het
Itpr2 C A 6: 146,415,354 K306N probably damaging Het
Kdm2a C T 19: 4,324,512 E864K possibly damaging Het
Kdm4b G A 17: 56,355,944 V172M probably damaging Het
Kyat3 A T 3: 142,737,844 K406M probably null Het
Lipe T A 7: 25,397,620 K299N possibly damaging Het
Lrrc2 T A 9: 110,966,517 C123* probably null Het
Mptx2 T A 1: 173,274,673 I150F probably damaging Het
Mroh2b G T 15: 4,923,620 W612L probably damaging Het
Mucl2 T C 15: 103,898,426 T27A possibly damaging Het
Nfx1 T A 4: 41,004,357 C709* probably null Het
Olfr164 A G 16: 19,285,946 S266P possibly damaging Het
Olfr624 A T 7: 103,670,146 I295N probably damaging Het
Oprm1 T C 10: 6,839,544 S390P probably benign Het
Pcdhb14 T C 18: 37,449,662 L607P probably damaging Het
Rap1gds1 A T 3: 138,965,960 I133N probably damaging Het
Rasl10a T C 11: 5,059,461 L83S probably damaging Het
Satb2 C T 1: 56,845,620 V382M probably damaging Het
Sh3gl1 T C 17: 56,018,949 K160R probably damaging Het
Sirt4 T C 5: 115,480,292 D241G probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Spef2 A G 15: 9,704,536 I454T probably damaging Het
Stag3 A G 5: 138,298,349 K490E probably benign Het
Tctn3 T C 19: 40,611,711 K95R probably benign Het
Tdgf1 C T 9: 110,943,190 R46Q probably benign Het
Trp53bp1 T C 2: 121,200,329 I1784V probably damaging Het
Ttc21a A T 9: 119,954,165 E511V probably damaging Het
Ttn A G 2: 76,711,888 F25258L probably damaging Het
Ttn A C 2: 76,808,946 C13828G probably damaging Het
Vmn1r210 T A 13: 22,827,403 M238L probably damaging Het
Vmn1r38 A G 6: 66,776,907 I75T probably benign Het
Vmn2r84 T A 10: 130,385,800 *850C probably null Het
Vwa7 T C 17: 35,025,159 probably null Het
Zfp128 T A 7: 12,884,732 D52E probably damaging Het
Zfp618 T C 4: 63,115,491 probably benign Het
Zkscan2 T A 7: 123,485,002 E633V possibly damaging Het
Other mutations in Aanat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01642:Aanat APN 11 116595688 missense possibly damaging 0.94
IGL02257:Aanat APN 11 116595709 nonsense probably null
IGL02649:Aanat APN 11 116595646 missense probably benign 0.38
R0894:Aanat UTSW 11 116596904 missense probably benign 0.41
R3771:Aanat UTSW 11 116596871 missense probably damaging 1.00
R3864:Aanat UTSW 11 116596816 missense probably damaging 1.00
R4468:Aanat UTSW 11 116596955 missense possibly damaging 0.47
R5585:Aanat UTSW 11 116596973 missense probably damaging 1.00
R6013:Aanat UTSW 11 116596124 critical splice acceptor site probably null
R6668:Aanat UTSW 11 116596042 intron probably benign
X0020:Aanat UTSW 11 116596798 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- TCTGTGCACAAACAGCAGGC -3'
(R):5'- TCCTACAGTTCGGGACTCTAAAG -3'

Sequencing Primer
(F):5'- TGCACAAACAGCAGGCAAGTG -3'
(R):5'- AGCAATTCTCAACCTGTGGG -3'
Posted On2015-03-25