Incidental Mutation 'R3792:Mroh2b'
ID272605
Institutional Source Beutler Lab
Gene Symbol Mroh2b
Ensembl Gene ENSMUSG00000022155
Gene Namemaestro heat-like repeat family member 2B
Synonyms4930455B06Rik, Heatr7b2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R3792 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location4898737-4962205 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 4923620 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 612 (W612L)
Ref Sequence ENSEMBL: ENSMUSP00000036148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045736]
Predicted Effect probably damaging
Transcript: ENSMUST00000045736
AA Change: W612L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155
AA Change: W612L

DomainStartEndE-ValueType
low complexity region 124 135 N/A INTRINSIC
low complexity region 824 842 N/A INTRINSIC
SCOP:d1gw5a_ 937 1443 7e-15 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930595M18Rik A G X: 81,420,817 V428A probably benign Het
Aanat T C 11: 116,596,231 L88P probably damaging Het
Arhgap5 A T 12: 52,519,888 N1214I probably benign Het
BC034090 A T 1: 155,241,797 S192T probably damaging Het
Bco1 G A 8: 117,130,676 V461I possibly damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Cubn G A 2: 13,427,914 R1199C probably damaging Het
Dcaf12l1 T C X: 44,788,436 N495S possibly damaging Het
Dopey2 C A 16: 93,771,846 Q1599K possibly damaging Het
Dyrk1a C A 16: 94,685,074 L427I probably benign Het
Esp16 T C 17: 39,537,848 I11T possibly damaging Het
Esyt3 A T 9: 99,315,281 F832Y possibly damaging Het
F8 A T X: 75,285,365 probably null Het
Fam135a T C 1: 24,028,311 Y259C probably benign Het
Fbxo38 T C 18: 62,533,462 probably null Het
Fbxo43 T C 15: 36,162,859 I67M probably benign Het
Gcfc2 G T 6: 81,930,767 C154F probably benign Het
Gm21731 G T 13: 120,240,931 V88F probably damaging Het
Hipk2 C T 6: 38,698,556 R1029H probably damaging Het
Ilk G A 7: 105,742,087 W73* probably null Het
Ism1 T C 2: 139,740,253 S162P probably damaging Het
Itpkb T A 1: 180,333,173 L288Q possibly damaging Het
Itpr2 C A 6: 146,415,354 K306N probably damaging Het
Kdm2a C T 19: 4,324,512 E864K possibly damaging Het
Kdm4b G A 17: 56,355,944 V172M probably damaging Het
Kyat3 A T 3: 142,737,844 K406M probably null Het
Lipe T A 7: 25,397,620 K299N possibly damaging Het
Lrrc2 T A 9: 110,966,517 C123* probably null Het
Mptx2 T A 1: 173,274,673 I150F probably damaging Het
Mucl2 T C 15: 103,898,426 T27A possibly damaging Het
Nfx1 T A 4: 41,004,357 C709* probably null Het
Olfr164 A G 16: 19,285,946 S266P possibly damaging Het
Olfr624 A T 7: 103,670,146 I295N probably damaging Het
Oprm1 T C 10: 6,839,544 S390P probably benign Het
Pcdhb14 T C 18: 37,449,662 L607P probably damaging Het
Rap1gds1 A T 3: 138,965,960 I133N probably damaging Het
Rasl10a T C 11: 5,059,461 L83S probably damaging Het
Satb2 C T 1: 56,845,620 V382M probably damaging Het
Sh3gl1 T C 17: 56,018,949 K160R probably damaging Het
Sirt4 T C 5: 115,480,292 D241G probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Spef2 A G 15: 9,704,536 I454T probably damaging Het
Stag3 A G 5: 138,298,349 K490E probably benign Het
Tctn3 T C 19: 40,611,711 K95R probably benign Het
Tdgf1 C T 9: 110,943,190 R46Q probably benign Het
Trp53bp1 T C 2: 121,200,329 I1784V probably damaging Het
Ttc21a A T 9: 119,954,165 E511V probably damaging Het
Ttn A G 2: 76,711,888 F25258L probably damaging Het
Ttn A C 2: 76,808,946 C13828G probably damaging Het
Vmn1r210 T A 13: 22,827,403 M238L probably damaging Het
Vmn1r38 A G 6: 66,776,907 I75T probably benign Het
Vmn2r84 T A 10: 130,385,800 *850C probably null Het
Vwa7 T C 17: 35,025,159 probably null Het
Zfp128 T A 7: 12,884,732 D52E probably damaging Het
Zfp618 T C 4: 63,115,491 probably benign Het
Zkscan2 T A 7: 123,485,002 E633V possibly damaging Het
Other mutations in Mroh2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Mroh2b APN 15 4899197 missense probably benign
IGL00507:Mroh2b APN 15 4962127 missense probably damaging 1.00
IGL00548:Mroh2b APN 15 4931316 missense probably benign 0.35
IGL00902:Mroh2b APN 15 4915222 missense probably damaging 1.00
IGL00944:Mroh2b APN 15 4951127 splice site probably benign
IGL00954:Mroh2b APN 15 4903054 missense probably damaging 0.99
IGL01015:Mroh2b APN 15 4941542 missense probably damaging 1.00
IGL01134:Mroh2b APN 15 4915152 missense probably benign 0.00
IGL01337:Mroh2b APN 15 4905024 missense probably benign 0.38
IGL01780:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL01919:Mroh2b APN 15 4923688 missense probably benign 0.10
IGL02069:Mroh2b APN 15 4904324 splice site probably benign
IGL02146:Mroh2b APN 15 4951294 splice site probably null
IGL02221:Mroh2b APN 15 4923641 missense probably damaging 1.00
IGL02281:Mroh2b APN 15 4952263 missense probably benign 0.04
IGL02350:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02357:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02401:Mroh2b APN 15 4900501 missense possibly damaging 0.71
IGL02427:Mroh2b APN 15 4951560 splice site probably benign
IGL02432:Mroh2b APN 15 4914186 missense probably benign
IGL02582:Mroh2b APN 15 4908515 missense probably damaging 0.98
IGL02632:Mroh2b APN 15 4931101 missense probably damaging 0.99
IGL02741:Mroh2b APN 15 4905632 missense probably benign
IGL02811:Mroh2b APN 15 4915236 missense possibly damaging 0.55
IGL02826:Mroh2b APN 15 4962148 missense probably damaging 0.99
IGL03412:Mroh2b APN 15 4944372 missense probably benign 0.14
PIT4468001:Mroh2b UTSW 15 4912812 missense probably damaging 1.00
R0024:Mroh2b UTSW 15 4925627 missense probably damaging 1.00
R0333:Mroh2b UTSW 15 4931118 missense probably damaging 1.00
R0433:Mroh2b UTSW 15 4941634 missense probably benign 0.01
R0530:Mroh2b UTSW 15 4934395 missense probably damaging 0.97
R1411:Mroh2b UTSW 15 4918317 missense probably damaging 1.00
R1457:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1472:Mroh2b UTSW 15 4948655 missense probably benign 0.00
R1525:Mroh2b UTSW 15 4951130 splice site probably null
R1584:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1605:Mroh2b UTSW 15 4945090 missense probably benign 0.08
R1657:Mroh2b UTSW 15 4931043 nonsense probably null
R1671:Mroh2b UTSW 15 4951294 splice site probably null
R1698:Mroh2b UTSW 15 4914140 missense probably benign 0.02
R2002:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R2005:Mroh2b UTSW 15 4917158 missense probably damaging 1.00
R2077:Mroh2b UTSW 15 4944966 missense probably damaging 1.00
R2179:Mroh2b UTSW 15 4921446 critical splice donor site probably null
R2183:Mroh2b UTSW 15 4918225 splice site probably null
R3713:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3714:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3747:Mroh2b UTSW 15 4952246 nonsense probably null
R3748:Mroh2b UTSW 15 4952246 nonsense probably null
R3749:Mroh2b UTSW 15 4952246 nonsense probably null
R3750:Mroh2b UTSW 15 4952246 nonsense probably null
R3872:Mroh2b UTSW 15 4925061 nonsense probably null
R4021:Mroh2b UTSW 15 4925100 missense possibly damaging 0.75
R4329:Mroh2b UTSW 15 4931379 missense probably damaging 0.99
R4456:Mroh2b UTSW 15 4947925 missense probably benign 0.21
R4592:Mroh2b UTSW 15 4918290 missense probably damaging 1.00
R4836:Mroh2b UTSW 15 4904270 missense probably damaging 1.00
R5050:Mroh2b UTSW 15 4900450 missense possibly damaging 0.82
R5230:Mroh2b UTSW 15 4941522 missense probably benign 0.07
R5342:Mroh2b UTSW 15 4914133 nonsense probably null
R5353:Mroh2b UTSW 15 4917178 missense probably damaging 1.00
R5368:Mroh2b UTSW 15 4905572 missense probably damaging 1.00
R5424:Mroh2b UTSW 15 4941612 missense probably damaging 0.98
R5484:Mroh2b UTSW 15 4908981 missense possibly damaging 0.92
R5999:Mroh2b UTSW 15 4912884 intron probably null
R6046:Mroh2b UTSW 15 4951281 missense probably benign 0.01
R6081:Mroh2b UTSW 15 4944377 missense probably damaging 1.00
R6162:Mroh2b UTSW 15 4915225 missense probably damaging 1.00
R6165:Mroh2b UTSW 15 4918350 missense probably benign 0.23
R6240:Mroh2b UTSW 15 4934644 missense probably benign 0.38
R6487:Mroh2b UTSW 15 4947239 missense probably damaging 1.00
R6539:Mroh2b UTSW 15 4905574 missense probably damaging 1.00
R6616:Mroh2b UTSW 15 4953282 missense probably benign 0.36
R6663:Mroh2b UTSW 15 4947935 missense probably benign 0.21
R6820:Mroh2b UTSW 15 4953274 missense probably damaging 1.00
R6900:Mroh2b UTSW 15 4908987 missense probably benign 0.00
R6990:Mroh2b UTSW 15 4912802 missense possibly damaging 0.55
R7067:Mroh2b UTSW 15 4900504 missense probably benign 0.35
R7092:Mroh2b UTSW 15 4934678 missense possibly damaging 0.92
R7102:Mroh2b UTSW 15 4948003 missense probably benign 0.06
R7264:Mroh2b UTSW 15 4921362 missense possibly damaging 0.81
R7436:Mroh2b UTSW 15 4941554 missense probably benign 0.21
R7462:Mroh2b UTSW 15 4908627 missense probably damaging 1.00
X0067:Mroh2b UTSW 15 4951591 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GCTCCAGTAAAGACAGAGCC -3'
(R):5'- ACAGACCAGGATTGTTCCAAGG -3'

Sequencing Primer
(F):5'- AGAGCCTGAAAGAAATGCTCTC -3'
(R):5'- CAGACCAGGATTGTTCCAAGGTTTTG -3'
Posted On2015-03-25