Mutagenetix > Incidental Mutation

Incidental Mutation 'R3793:Kirrel1'

272633

Institutional Source

Beutler Lab

Gene Symbol

Kirrel1

Ensembl Gene

ENSMUSG00000041734

Gene Name

kirre like nephrin family adhesion molecule 1

Synonyms

6720469N11Rik, Neph1, Kirrel1, Kirrel

MMRRC Submission

040755-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3793 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86985900-87082054 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 86996458 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 380 (M380I)

Ref Sequence

ENSEMBL: ENSMUSP00000125525 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041732] [ENSMUST00000107618] [ENSMUST00000159976]

AlphaFold

Q80W68

Predicted Effect

probably null
Transcript: ENSMUST00000041732
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000043756
Gene: ENSMUSG00000041734
AA Change: M380I

Domain	Start	End	E-Value	Type
IG	59	149	3.62e-10	SMART
IG_like	160	252	1.27e1	SMART
IG_like	261	337	1.89e1	SMART
IGc2	352	410	3.28e-8	SMART
IG_like	430	522	5.71e0	SMART
transmembrane domain	529	551	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000107618
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000103243
Gene: ENSMUSG00000041734
AA Change: M380I

Domain	Start	End	E-Value	Type
IG	59	149	3.62e-10	SMART
IG_like	160	252	1.27e1	SMART
IG_like	261	337	1.89e1	SMART
IGc2	352	410	3.28e-8	SMART
IG_like	430	522	5.71e0	SMART
transmembrane domain	529	551	N/A	INTRINSIC
low complexity region	694	712	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000159976
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000125525
Gene: ENSMUSG00000041734
AA Change: M380I

Domain	Start	End	E-Value	Type
IG	59	149	3.62e-10	SMART
IG_like	160	252	1.27e1	SMART
IG_like	261	337	1.89e1	SMART
IGc2	352	410	3.28e-8	SMART
IG_like	430	522	5.71e0	SMART
transmembrane domain	529	551	N/A	INTRINSIC
low complexity region	694	712	N/A	INTRINSIC

Meta Mutation Damage Score

0.0922

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 92.4%

Validation Efficiency

98% (50/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NEPH1 is a member of the nephrin-like protein family, which includes NEPH2 (MIM 607761) and NEPH3 (MIM 607762). The cytoplasmic domains of these proteins interact with the C terminus of podocin (NPHS2; MIM 604766), and the genes are expressed in kidney podocytes, cells involved in ensuring size- and charge-selective ultrafiltration (Sellin et al., 2003 [PubMed 12424224]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap insertion exhibit postnatal lethality and are small and sickly. Glomerular and tubular defects in the kidney result in severe proteinuria. [provided by MGI curators]

Allele List at MGI

All alleles(121) : Targeted, other(2) Gene trapped(119)

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap13	A	G	7: 75,259,889 (GRCm39)	T35A	probably benign	Het
Arhgap32	T	A	9: 32,166,669 (GRCm39)	S435R	probably damaging	Het
Asic1	A	T	15: 99,569,906 (GRCm39)	K76*	probably null	Het
B9d1	A	G	11: 61,398,448 (GRCm39)		probably benign	Het
Casd1	T	C	6: 4,619,876 (GRCm39)	V207A	possibly damaging	Het
Cass4	C	T	2: 172,274,478 (GRCm39)	P753L	probably damaging	Het
Cnfn	T	C	7: 25,067,805 (GRCm39)	N45S	probably benign	Het
Col14a1	G	T	15: 55,226,909 (GRCm39)	D220Y	unknown	Het
Csn1s1	T	A	5: 87,828,702 (GRCm39)	Y274*	probably null	Het
Cyp2c69	T	C	19: 39,869,600 (GRCm39)	T140A	probably benign	Het
Dlg2	A	T	7: 91,459,743 (GRCm39)		probably benign	Het
Esp16	T	C	17: 39,848,739 (GRCm39)	I11T	possibly damaging	Het
Esyt3	A	T	9: 99,197,334 (GRCm39)	F832Y	possibly damaging	Het
Ift172	C	T	5: 31,414,925 (GRCm39)	D1366N	possibly damaging	Het
Itga4	A	G	2: 79,109,472 (GRCm39)	T224A	probably benign	Het
Itprid1	A	T	6: 55,952,588 (GRCm39)	M844L	possibly damaging	Het
Krt71	C	T	15: 101,651,345 (GRCm39)	S46N	probably damaging	Het
Lhx1	A	G	11: 84,412,726 (GRCm39)	S65P	probably benign	Het
Lingo4	A	G	3: 94,309,685 (GRCm39)	S208G	probably benign	Het
Lrrc2	T	A	9: 110,795,585 (GRCm39)	C123*	probably null	Het
Nfrkb	A	T	9: 31,321,228 (GRCm39)		probably benign	Het
Nfx1	T	A	4: 41,004,357 (GRCm39)	C709*	probably null	Het
Nlrp14	A	T	7: 106,781,481 (GRCm39)	Q226L	probably benign	Het
Ocln	T	C	13: 100,635,402 (GRCm39)	R496G	possibly damaging	Het
Or2b2b	T	C	13: 21,859,153 (GRCm39)		probably null	Het
Or7e173	T	A	9: 19,938,359 (GRCm39)	I292F	probably damaging	Het
Osgepl1	T	C	1: 53,359,406 (GRCm39)	I305T	probably damaging	Het
Ovgp1	A	G	3: 105,887,487 (GRCm39)	N266S	probably benign	Het
Per1	A	G	11: 69,000,127 (GRCm39)	E1273G	probably benign	Het
Plch1	A	G	3: 63,605,252 (GRCm39)	Y1542H	probably damaging	Het
Pold1	A	G	7: 44,190,994 (GRCm39)	F252L	probably damaging	Het
Ptk2b	A	T	14: 66,407,700 (GRCm39)	D607E	probably damaging	Het
Sdf4	T	A	4: 156,086,916 (GRCm39)		probably null	Het
Sirt4	T	C	5: 115,618,351 (GRCm39)	D241G	probably benign	Het
Sla2	G	A	2: 156,717,862 (GRCm39)	R137C	probably damaging	Het
Slco1b2	A	G	6: 141,622,033 (GRCm39)	Y531C	probably damaging	Het
Tmem200a	A	T	10: 25,870,087 (GRCm39)	S61T	probably damaging	Het
Trp53bp1	T	C	2: 121,030,810 (GRCm39)	I1784V	probably damaging	Het
Uba2	A	C	7: 33,845,722 (GRCm39)	V467G	probably damaging	Het
Ubr3	T	C	2: 69,747,525 (GRCm39)	S263P	possibly damaging	Het
Ugt2b35	A	G	5: 87,149,465 (GRCm39)	T239A	probably benign	Het
Wac	T	C	18: 7,920,190 (GRCm39)	V348A	possibly damaging	Het
Wdr3	A	T	3: 100,059,281 (GRCm39)	M346K	probably benign	Het
Zfp607a	A	T	7: 27,578,331 (GRCm39)	H467L	probably benign	Het

Other mutations in Kirrel1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01310:Kirrel1	APN	3	86,997,182 (GRCm39)	missense	probably benign	0.22
IGL01865:Kirrel1	APN	3	86,993,731 (GRCm39)	missense	probably damaging	1.00
IGL01875:Kirrel1	APN	3	87,003,037 (GRCm39)	missense	probably damaging	1.00
IGL02337:Kirrel1	APN	3	86,996,519 (GRCm39)	missense	possibly damaging	0.64
IGL02724:Kirrel1	APN	3	86,997,780 (GRCm39)	nonsense	probably null
IGL02825:Kirrel1	APN	3	86,996,595 (GRCm39)	splice site	probably benign
IGL02826:Kirrel1	APN	3	86,995,792 (GRCm39)	missense	probably damaging	1.00
IGL03102:Kirrel1	APN	3	86,990,807 (GRCm39)	missense	probably damaging	0.98
D4043:Kirrel1	UTSW	3	86,990,510 (GRCm39)	missense	probably benign	0.02
R0360:Kirrel1	UTSW	3	86,997,106 (GRCm39)	missense	probably damaging	1.00
R0364:Kirrel1	UTSW	3	86,997,106 (GRCm39)	missense	probably damaging	1.00
R0421:Kirrel1	UTSW	3	86,990,914 (GRCm39)	missense	probably damaging	0.99
R0503:Kirrel1	UTSW	3	87,005,109 (GRCm39)	missense	probably benign	0.20
R1112:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1116:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1144:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1147:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1147:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1190:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1226:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1501:Kirrel1	UTSW	3	86,997,779 (GRCm39)	missense	probably benign	0.02
R1538:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1546:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1628:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1630:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1631:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1664:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1671:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1695:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1769:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1807:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1808:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1840:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1876:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1995:Kirrel1	UTSW	3	87,003,093 (GRCm39)	missense	possibly damaging	0.88
R2014:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2086:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2108:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2354:Kirrel1	UTSW	3	86,995,792 (GRCm39)	missense	probably damaging	0.98
R2407:Kirrel1	UTSW	3	86,992,150 (GRCm39)	missense	probably benign	0.03
R2904:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2905:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2958:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2959:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2960:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2961:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3026:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3028:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3034:Kirrel1	UTSW	3	86,990,746 (GRCm39)	missense	possibly damaging	0.56
R3149:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3195:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3196:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3499:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3699:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3720:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3721:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3788:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3876:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3877:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3901:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3910:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3911:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3912:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3913:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3930:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3931:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4022:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4067:Kirrel1	UTSW	3	86,995,774 (GRCm39)	nonsense	probably null
R4077:Kirrel1	UTSW	3	86,992,387 (GRCm39)	critical splice donor site	probably null
R4198:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4328:Kirrel1	UTSW	3	86,992,081 (GRCm39)	intron	probably benign
R4355:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4363:Kirrel1	UTSW	3	86,997,792 (GRCm39)	nonsense	probably null
R4378:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4386:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4460:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4468:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4469:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4650:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4652:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4734:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4748:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4749:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R5304:Kirrel1	UTSW	3	86,996,902 (GRCm39)	missense	probably benign	0.02
R5534:Kirrel1	UTSW	3	86,997,825 (GRCm39)	missense	probably damaging	1.00
R5604:Kirrel1	UTSW	3	86,996,462 (GRCm39)	missense	possibly damaging	0.69
R7199:Kirrel1	UTSW	3	86,990,695 (GRCm39)	missense	probably benign	0.02
R7221:Kirrel1	UTSW	3	86,993,704 (GRCm39)	nonsense	probably null
R7284:Kirrel1	UTSW	3	86,990,694 (GRCm39)	missense	probably benign	0.02
R7332:Kirrel1	UTSW	3	86,995,705 (GRCm39)	missense	probably benign	0.14
R7369:Kirrel1	UTSW	3	87,048,391 (GRCm39)	missense	probably benign	0.20
R7371:Kirrel1	UTSW	3	86,995,729 (GRCm39)	missense	probably benign	0.44
R7508:Kirrel1	UTSW	3	86,990,746 (GRCm39)	missense	possibly damaging	0.56
R7566:Kirrel1	UTSW	3	86,995,791 (GRCm39)	missense	probably damaging	1.00
R7567:Kirrel1	UTSW	3	87,002,988 (GRCm39)	missense	probably damaging	0.99
R7621:Kirrel1	UTSW	3	86,995,528 (GRCm39)	missense	possibly damaging	0.70
R8030:Kirrel1	UTSW	3	87,005,082 (GRCm39)	missense	probably damaging	1.00
R8141:Kirrel1	UTSW	3	86,993,735 (GRCm39)	nonsense	probably null
R8261:Kirrel1	UTSW	3	86,995,309 (GRCm39)	intron	probably benign
R8477:Kirrel1	UTSW	3	86,992,138 (GRCm39)	missense	possibly damaging	0.71
R8512:Kirrel1	UTSW	3	86,995,534 (GRCm39)	missense	probably benign	0.00
R8954:Kirrel1	UTSW	3	86,997,173 (GRCm39)	missense	probably benign	0.25
R8987:Kirrel1	UTSW	3	86,992,400 (GRCm39)	missense	probably damaging	1.00
R9058:Kirrel1	UTSW	3	86,992,442 (GRCm39)	missense	probably benign	0.18
R9146:Kirrel1	UTSW	3	87,003,015 (GRCm39)	missense	probably damaging	1.00
R9311:Kirrel1	UTSW	3	87,005,123 (GRCm39)	missense	probably benign	0.29
R9527:Kirrel1	UTSW	3	86,996,912 (GRCm39)	nonsense	probably null
R9629:Kirrel1	UTSW	3	87,003,025 (GRCm39)	nonsense	probably null
Z1177:Kirrel1	UTSW	3	86,991,182 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CACCCTGAGTTCTATGCAAGTC -3'
(R):5'- GCTGATGATTCTCAGGCACC -3'

Sequencing Primer
(F):5'- TATGGCTGACTGCAAGTACC -3'
(R):5'- TCAGGCACCTGAGACTCTGAC -3'

Posted On

2015-03-25