Incidental Mutation 'R3793:Esyt3'
ID272658
Institutional Source Beutler Lab
Gene Symbol Esyt3
Ensembl Gene ENSMUSG00000037681
Gene Nameextended synaptotagmin-like protein 3
SynonymsFam62c, D9Ertd280e
MMRRC Submission 040755-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.236) question?
Stock #R3793 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location99309963-99358557 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 99315281 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 832 (F832Y)
Ref Sequence ENSEMBL: ENSMUSP00000038757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042158] [ENSMUST00000187520]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042158
AA Change: F832Y

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000038757
Gene: ENSMUSG00000037681
AA Change: F832Y

DomainStartEndE-ValueType
transmembrane domain 54 76 N/A INTRINSIC
Pfam:SMP_LBD 118 295 3.7e-63 PFAM
C2 311 411 9.23e-20 SMART
low complexity region 422 432 N/A INTRINSIC
C2 449 563 6.6e-7 SMART
low complexity region 658 673 N/A INTRINSIC
low complexity region 729 739 N/A INTRINSIC
C2 775 880 4.91e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186626
Predicted Effect probably benign
Transcript: ENSMUST00000187520
SMART Domains Protein: ENSMUSP00000140567
Gene: ENSMUSG00000037681

DomainStartEndE-ValueType
C2 2 83 5.9e-12 SMART
low complexity region 94 104 N/A INTRINSIC
C2 121 198 2.2e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195185
Meta Mutation Damage Score 0.19 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.4%
Validation Efficiency 98% (50/51)
MGI Phenotype PHENOTYPE: Mice are viable and fertile without overt morphological defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 A G 7: 75,610,141 T35A probably benign Het
Arhgap32 T A 9: 32,255,373 S435R probably damaging Het
Asic1 A T 15: 99,672,025 K76* probably null Het
B9d1 A G 11: 61,507,622 probably benign Het
Casd1 T C 6: 4,619,876 V207A possibly damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Ccdc129 A T 6: 55,975,603 M844L possibly damaging Het
Cnfn T C 7: 25,368,380 N45S probably benign Het
Col14a1 G T 15: 55,363,513 D220Y unknown Het
Csn1s1 T A 5: 87,680,843 Y274* probably null Het
Cyp2c69 T C 19: 39,881,156 T140A probably benign Het
Dlg2 A T 7: 91,810,535 probably benign Het
Esp16 T C 17: 39,537,848 I11T possibly damaging Het
Ift172 C T 5: 31,257,581 D1366N possibly damaging Het
Itga4 A G 2: 79,279,128 T224A probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt71 C T 15: 101,742,910 S46N probably damaging Het
Lhx1 A G 11: 84,521,900 S65P probably benign Het
Lingo4 A G 3: 94,402,378 S208G probably benign Het
Lrrc2 T A 9: 110,966,517 C123* probably null Het
Nfrkb A T 9: 31,409,932 probably benign Het
Nfx1 T A 4: 41,004,357 C709* probably null Het
Nlrp14 A T 7: 107,182,274 Q226L probably benign Het
Ocln T C 13: 100,498,894 R496G possibly damaging Het
Olfr1360 T C 13: 21,674,983 probably null Het
Olfr866 T A 9: 20,027,063 I292F probably damaging Het
Osgepl1 T C 1: 53,320,247 I305T probably damaging Het
Ovgp1 A G 3: 105,980,171 N266S probably benign Het
Per1 A G 11: 69,109,301 E1273G probably benign Het
Plch1 A G 3: 63,697,831 Y1542H probably damaging Het
Pold1 A G 7: 44,541,570 F252L probably damaging Het
Ptk2b A T 14: 66,170,251 D607E probably damaging Het
Sdf4 T A 4: 156,002,459 probably null Het
Sirt4 T C 5: 115,480,292 D241G probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slco1b2 A G 6: 141,676,307 Y531C probably damaging Het
Tmem200a A T 10: 25,994,189 S61T probably damaging Het
Trp53bp1 T C 2: 121,200,329 I1784V probably damaging Het
Uba2 A C 7: 34,146,297 V467G probably damaging Het
Ubr3 T C 2: 69,917,181 S263P possibly damaging Het
Ugt2b35 A G 5: 87,001,606 T239A probably benign Het
Wac T C 18: 7,920,190 V348A possibly damaging Het
Wdr3 A T 3: 100,151,965 M346K probably benign Het
Zfp607a A T 7: 27,878,906 H467L probably benign Het
Other mutations in Esyt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02576:Esyt3 APN 9 99315225 missense probably benign 0.07
IGL02596:Esyt3 APN 9 99328015 missense probably benign 0.02
IGL02716:Esyt3 APN 9 99317224 missense probably damaging 1.00
IGL02836:Esyt3 APN 9 99320907 splice site probably benign
IGL03372:Esyt3 APN 9 99336056 splice site probably benign
R0008:Esyt3 UTSW 9 99338807 missense possibly damaging 0.89
R1217:Esyt3 UTSW 9 99318044 missense possibly damaging 0.92
R1395:Esyt3 UTSW 9 99316782 unclassified probably benign
R1478:Esyt3 UTSW 9 99318066 missense probably benign 0.03
R1710:Esyt3 UTSW 9 99336191 missense probably benign
R1792:Esyt3 UTSW 9 99358116 nonsense probably null
R1913:Esyt3 UTSW 9 99320311 missense probably benign 0.00
R3792:Esyt3 UTSW 9 99315281 missense possibly damaging 0.93
R3937:Esyt3 UTSW 9 99336192 missense probably benign
R3964:Esyt3 UTSW 9 99320322 missense probably damaging 1.00
R3965:Esyt3 UTSW 9 99320322 missense probably damaging 1.00
R4061:Esyt3 UTSW 9 99320838 missense probably damaging 1.00
R4088:Esyt3 UTSW 9 99324237 missense probably benign
R4436:Esyt3 UTSW 9 99358025 intron probably benign
R5274:Esyt3 UTSW 9 99318297 missense probably benign
R5590:Esyt3 UTSW 9 99358413 utr 5 prime probably benign
R5705:Esyt3 UTSW 9 99318207 missense probably benign 0.00
R6543:Esyt3 UTSW 9 99338772 missense possibly damaging 0.77
R6738:Esyt3 UTSW 9 99320293 missense probably damaging 0.98
R7000:Esyt3 UTSW 9 99322153 missense probably damaging 0.99
R7019:Esyt3 UTSW 9 99315285 missense probably benign 0.11
R7104:Esyt3 UTSW 9 99338787 missense probably damaging 1.00
R7130:Esyt3 UTSW 9 99318170 missense probably benign
R7141:Esyt3 UTSW 9 99321440 missense probably benign 0.12
R7145:Esyt3 UTSW 9 99319574 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGTAGGTGCCACATACTTATGG -3'
(R):5'- GACTAAGACGCACTGAGAGC -3'

Sequencing Primer
(F):5'- GGTGCCACATACTTATGGAATATTG -3'
(R):5'- ACTGAGAGCCTGGGAGC -3'
Posted On2015-03-25