Incidental Mutation 'R3793:Cyp2c69'
ID272674
Institutional Source Beutler Lab
Gene Symbol Cyp2c69
Ensembl Gene ENSMUSG00000092008
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 69
SynonymsAI098658
MMRRC Submission 040755-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R3793 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location39842660-39886769 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39881156 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 140 (T140A)
Ref Sequence ENSEMBL: ENSMUSP00000132832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168838]
Predicted Effect probably benign
Transcript: ENSMUST00000168838
AA Change: T140A

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132832
Gene: ENSMUSG00000092008
AA Change: T140A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 487 7e-152 PFAM
Meta Mutation Damage Score 0.1528 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.4%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 A G 7: 75,610,141 T35A probably benign Het
Arhgap32 T A 9: 32,255,373 S435R probably damaging Het
Asic1 A T 15: 99,672,025 K76* probably null Het
B9d1 A G 11: 61,507,622 probably benign Het
Casd1 T C 6: 4,619,876 V207A possibly damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Ccdc129 A T 6: 55,975,603 M844L possibly damaging Het
Cnfn T C 7: 25,368,380 N45S probably benign Het
Col14a1 G T 15: 55,363,513 D220Y unknown Het
Csn1s1 T A 5: 87,680,843 Y274* probably null Het
Dlg2 A T 7: 91,810,535 probably benign Het
Esp16 T C 17: 39,537,848 I11T possibly damaging Het
Esyt3 A T 9: 99,315,281 F832Y possibly damaging Het
Ift172 C T 5: 31,257,581 D1366N possibly damaging Het
Itga4 A G 2: 79,279,128 T224A probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt71 C T 15: 101,742,910 S46N probably damaging Het
Lhx1 A G 11: 84,521,900 S65P probably benign Het
Lingo4 A G 3: 94,402,378 S208G probably benign Het
Lrrc2 T A 9: 110,966,517 C123* probably null Het
Nfrkb A T 9: 31,409,932 probably benign Het
Nfx1 T A 4: 41,004,357 C709* probably null Het
Nlrp14 A T 7: 107,182,274 Q226L probably benign Het
Ocln T C 13: 100,498,894 R496G possibly damaging Het
Olfr1360 T C 13: 21,674,983 probably null Het
Olfr866 T A 9: 20,027,063 I292F probably damaging Het
Osgepl1 T C 1: 53,320,247 I305T probably damaging Het
Ovgp1 A G 3: 105,980,171 N266S probably benign Het
Per1 A G 11: 69,109,301 E1273G probably benign Het
Plch1 A G 3: 63,697,831 Y1542H probably damaging Het
Pold1 A G 7: 44,541,570 F252L probably damaging Het
Ptk2b A T 14: 66,170,251 D607E probably damaging Het
Sdf4 T A 4: 156,002,459 probably null Het
Sirt4 T C 5: 115,480,292 D241G probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slco1b2 A G 6: 141,676,307 Y531C probably damaging Het
Tmem200a A T 10: 25,994,189 S61T probably damaging Het
Trp53bp1 T C 2: 121,200,329 I1784V probably damaging Het
Uba2 A C 7: 34,146,297 V467G probably damaging Het
Ubr3 T C 2: 69,917,181 S263P possibly damaging Het
Ugt2b35 A G 5: 87,001,606 T239A probably benign Het
Wac T C 18: 7,920,190 V348A possibly damaging Het
Wdr3 A T 3: 100,151,965 M346K probably benign Het
Zfp607a A T 7: 27,878,906 H467L probably benign Het
Other mutations in Cyp2c69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01873:Cyp2c69 APN 19 39881249 splice site probably benign
IGL02127:Cyp2c69 APN 19 39851057 missense probably damaging 0.99
IGL02945:Cyp2c69 APN 19 39886647 missense possibly damaging 0.81
IGL03067:Cyp2c69 APN 19 39881093 missense probably benign 0.29
IGL03069:Cyp2c69 APN 19 39881093 missense probably benign 0.29
R0545:Cyp2c69 UTSW 19 39886661 missense probably damaging 1.00
R1276:Cyp2c69 UTSW 19 39876224 missense possibly damaging 0.47
R1468:Cyp2c69 UTSW 19 39849395 missense probably damaging 1.00
R1468:Cyp2c69 UTSW 19 39849395 missense probably damaging 1.00
R1534:Cyp2c69 UTSW 19 39851149 missense probably benign
R1549:Cyp2c69 UTSW 19 39842986 missense probably benign 0.11
R1703:Cyp2c69 UTSW 19 39876366 missense probably benign 0.10
R1752:Cyp2c69 UTSW 19 39881153 missense probably damaging 1.00
R1769:Cyp2c69 UTSW 19 39876371 missense probably benign 0.00
R1843:Cyp2c69 UTSW 19 39877528 missense probably benign 0.27
R1938:Cyp2c69 UTSW 19 39849366 missense probably damaging 0.97
R2100:Cyp2c69 UTSW 19 39886686 missense probably benign 0.11
R2366:Cyp2c69 UTSW 19 39877594 missense probably benign 0.12
R2367:Cyp2c69 UTSW 19 39877594 missense probably benign 0.12
R2440:Cyp2c69 UTSW 19 39876294 missense probably benign 0.17
R2931:Cyp2c69 UTSW 19 39849483 missense probably damaging 1.00
R3709:Cyp2c69 UTSW 19 39851223 splice site probably benign
R3898:Cyp2c69 UTSW 19 39876390 missense probably benign 0.00
R4579:Cyp2c69 UTSW 19 39881186 missense possibly damaging 0.89
R4707:Cyp2c69 UTSW 19 39849408 missense probably benign 0.39
R4778:Cyp2c69 UTSW 19 39877594 missense probably benign 0.12
R4779:Cyp2c69 UTSW 19 39877594 missense probably benign 0.12
R4780:Cyp2c69 UTSW 19 39877594 missense probably benign 0.12
R4838:Cyp2c69 UTSW 19 39877594 missense probably benign 0.12
R4877:Cyp2c69 UTSW 19 39877612 missense probably damaging 1.00
R5488:Cyp2c69 UTSW 19 39851159 missense probably null 0.94
R5489:Cyp2c69 UTSW 19 39851159 missense probably null 0.94
R6083:Cyp2c69 UTSW 19 39849456 missense probably damaging 1.00
R6278:Cyp2c69 UTSW 19 39843063 nonsense probably null
R6415:Cyp2c69 UTSW 19 39842921 missense probably benign 0.44
R6732:Cyp2c69 UTSW 19 39881499 missense probably benign
R6858:Cyp2c69 UTSW 19 39877565 missense probably benign 0.19
R7023:Cyp2c69 UTSW 19 39877542 missense probably benign 0.43
R7227:Cyp2c69 UTSW 19 39881166 missense possibly damaging 0.77
R7228:Cyp2c69 UTSW 19 39881166 missense possibly damaging 0.77
R7260:Cyp2c69 UTSW 19 39842900 missense probably benign 0.00
R7262:Cyp2c69 UTSW 19 39886732 start gained probably benign
R7479:Cyp2c69 UTSW 19 39881557 missense probably benign 0.00
R7570:Cyp2c69 UTSW 19 39859898 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTATACTCATGACATCCCATTAG -3'
(R):5'- TTCCAGAGCAAGCTGAAAGG -3'

Sequencing Primer
(F):5'- TCTGACCTGCACTTACCA -3'
(R):5'- AGAGTAGAGGTCATGCTTGC -3'
Posted On2015-03-25