Incidental Mutation 'R3794:Vps13d'
ID 272683
Institutional Source Beutler Lab
Gene Symbol Vps13d
Ensembl Gene ENSMUSG00000020220
Gene Name vacuolar protein sorting 13D
Synonyms
MMRRC Submission 040756-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3794 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 144699192-144921575 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) G to A at 144812007 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000020441] [ENSMUST00000036579] [ENSMUST00000130704]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000020441
SMART Domains Protein: ENSMUSP00000020441
Gene: ENSMUSG00000020220

DomainStartEndE-ValueType
Pfam:Chorein_N 2 118 1.8e-37 PFAM
low complexity region 407 423 N/A INTRINSIC
low complexity region 534 555 N/A INTRINSIC
coiled coil region 665 685 N/A INTRINSIC
low complexity region 765 781 N/A INTRINSIC
low complexity region 1316 1329 N/A INTRINSIC
low complexity region 1590 1603 N/A INTRINSIC
Blast:IL1 1605 1726 2e-6 BLAST
low complexity region 1868 1883 N/A INTRINSIC
low complexity region 2128 2141 N/A INTRINSIC
UBA 2632 2669 3.73e-5 SMART
low complexity region 2674 2684 N/A INTRINSIC
low complexity region 2707 2718 N/A INTRINSIC
low complexity region 2866 2884 N/A INTRINSIC
low complexity region 2973 2983 N/A INTRINSIC
Pfam:DUF1162 3246 3530 1.1e-110 PFAM
low complexity region 3797 3810 N/A INTRINSIC
low complexity region 3913 3921 N/A INTRINSIC
low complexity region 4119 4132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036579
SMART Domains Protein: ENSMUSP00000043240
Gene: ENSMUSG00000020220

DomainStartEndE-ValueType
Pfam:Chorein_N 2 116 3.5e-35 PFAM
Pfam:VPS13 131 353 9.6e-57 PFAM
low complexity region 407 423 N/A INTRINSIC
low complexity region 534 555 N/A INTRINSIC
Pfam:VPS13_mid_rpt 608 896 4.3e-35 PFAM
low complexity region 1316 1329 N/A INTRINSIC
low complexity region 1590 1603 N/A INTRINSIC
Blast:IL1 1605 1726 2e-6 BLAST
low complexity region 1868 1883 N/A INTRINSIC
low complexity region 2128 2141 N/A INTRINSIC
UBA 2632 2669 3.73e-5 SMART
low complexity region 2674 2684 N/A INTRINSIC
low complexity region 2707 2718 N/A INTRINSIC
low complexity region 2891 2909 N/A INTRINSIC
low complexity region 2998 3008 N/A INTRINSIC
Pfam:SHR-BD 3271 3555 4.2e-86 PFAM
low complexity region 3822 3835 N/A INTRINSIC
low complexity region 3938 3946 N/A INTRINSIC
Pfam:VPS13_C 3978 4126 4.8e-24 PFAM
low complexity region 4144 4157 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130704
SMART Domains Protein: ENSMUSP00000118699
Gene: ENSMUSG00000020220

DomainStartEndE-ValueType
Pfam:DUF1162 162 446 1.4e-111 PFAM
low complexity region 713 726 N/A INTRINSIC
low complexity region 829 837 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185113
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the vacuolar-protein-sorting-13 gene family. In yeast, vacuolar-protein-sorting-13 proteins are involved in trafficking of membrane proteins between the trans-Golgi network and the prevacuolar compartment. While several transcript variants may exist for this gene, the full-length natures of only two have been described to date. These two represent the major variants of this gene and encode distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 C T 15: 98,496,824 (GRCm39) V482I probably damaging Het
Adgrv1 T A 13: 81,431,486 (GRCm39) M1L probably damaging Het
Ceacam13 A G 7: 17,747,340 (GRCm39) *264W probably null Het
Dennd5b A T 6: 149,002,715 (GRCm39) D31E possibly damaging Het
Dip2c T C 13: 9,654,597 (GRCm39) V706A probably damaging Het
Enpp3 T C 10: 24,707,630 (GRCm39) probably null Het
Exoc4 T G 6: 33,452,932 (GRCm39) V474G probably benign Het
F2rl1 A G 13: 95,649,719 (GRCm39) Y388H unknown Het
Fasl T C 1: 161,609,306 (GRCm39) R17G probably benign Het
Htr1a G A 13: 105,580,852 (GRCm39) V31M possibly damaging Het
Inpp4b T C 8: 82,759,845 (GRCm39) V445A probably damaging Het
Itih3 T C 14: 30,640,351 (GRCm39) Y319C probably damaging Het
Katnip A G 7: 125,419,261 (GRCm39) N476S probably benign Het
Kmt2d T C 15: 98,735,240 (GRCm39) probably benign Het
Mobp A T 9: 119,997,033 (GRCm39) K55* probably null Het
Ndufaf5 T A 2: 140,044,843 (GRCm39) M279K possibly damaging Het
Nlrc3 T C 16: 3,765,739 (GRCm39) I1057V probably benign Het
Or10al7 A G 17: 38,365,786 (GRCm39) Y224H probably damaging Het
Or4c112 G T 2: 88,853,770 (GRCm39) H192Q probably benign Het
Piezo2 C T 18: 63,214,864 (GRCm39) R1257Q probably damaging Het
Pigv A G 4: 133,392,502 (GRCm39) S223P possibly damaging Het
Pkdcc A G 17: 83,531,382 (GRCm39) T464A probably damaging Het
Polr2k A G 15: 36,175,193 (GRCm39) I18V probably damaging Het
Pon3 A G 6: 5,221,578 (GRCm39) Y351H probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Scaf8 A G 17: 3,240,524 (GRCm39) E632G probably damaging Het
Smurf1 A G 5: 144,837,985 (GRCm39) probably null Het
Tex16 T G X: 111,150,375 (GRCm39) M1R probably null Het
Tln1 G T 4: 43,536,295 (GRCm39) A1999D probably damaging Het
Trgv5 A T 13: 19,376,694 (GRCm39) H47L probably benign Het
Ttn C T 2: 76,772,781 (GRCm39) V2405I possibly damaging Het
Xrcc1 A G 7: 24,269,985 (GRCm39) T469A probably benign Het
Zfp287 G T 11: 62,605,070 (GRCm39) H612Q probably damaging Het
Zfp352 C T 4: 90,113,386 (GRCm39) H509Y probably damaging Het
Other mutations in Vps13d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Vps13d APN 4 144,895,110 (GRCm39) missense probably damaging 0.98
IGL00484:Vps13d APN 4 144,853,145 (GRCm39) missense probably benign 0.04
IGL00591:Vps13d APN 4 144,917,129 (GRCm39) missense possibly damaging 0.95
IGL00816:Vps13d APN 4 144,882,564 (GRCm39) missense probably benign 0.00
IGL00835:Vps13d APN 4 144,887,222 (GRCm39) missense probably damaging 0.97
IGL00847:Vps13d APN 4 144,811,978 (GRCm39) missense probably benign 0.26
IGL01084:Vps13d APN 4 144,881,525 (GRCm39) missense probably benign 0.00
IGL01116:Vps13d APN 4 144,699,320 (GRCm39) unclassified probably benign
IGL01150:Vps13d APN 4 144,875,845 (GRCm39) missense probably benign
IGL01329:Vps13d APN 4 144,882,776 (GRCm39) missense possibly damaging 0.69
IGL01338:Vps13d APN 4 144,814,892 (GRCm39) missense probably damaging 1.00
IGL01583:Vps13d APN 4 144,771,658 (GRCm39) missense probably damaging 1.00
IGL01598:Vps13d APN 4 144,743,471 (GRCm39) missense probably benign 0.21
IGL01620:Vps13d APN 4 144,821,437 (GRCm39) missense possibly damaging 0.70
IGL01636:Vps13d APN 4 144,801,618 (GRCm39) missense probably damaging 1.00
IGL01723:Vps13d APN 4 144,899,715 (GRCm39) missense possibly damaging 0.84
IGL01895:Vps13d APN 4 144,882,836 (GRCm39) missense possibly damaging 0.57
IGL01981:Vps13d APN 4 144,813,317 (GRCm39) missense probably damaging 0.99
IGL02192:Vps13d APN 4 144,875,428 (GRCm39) missense probably benign 0.02
IGL02197:Vps13d APN 4 144,854,879 (GRCm39) missense probably benign 0.01
IGL02209:Vps13d APN 4 144,882,671 (GRCm39) missense probably damaging 0.97
IGL02219:Vps13d APN 4 144,894,716 (GRCm39) missense probably benign 0.00
IGL02377:Vps13d APN 4 144,882,934 (GRCm39) missense probably damaging 1.00
IGL02404:Vps13d APN 4 144,875,305 (GRCm39) missense probably damaging 1.00
IGL02552:Vps13d APN 4 144,899,707 (GRCm39) missense possibly damaging 0.46
IGL02651:Vps13d APN 4 144,891,129 (GRCm39) missense probably benign 0.02
IGL02708:Vps13d APN 4 144,854,850 (GRCm39) missense probably benign 0.12
IGL02811:Vps13d APN 4 144,858,335 (GRCm39) missense possibly damaging 0.55
IGL02821:Vps13d APN 4 144,875,332 (GRCm39) missense probably damaging 0.98
IGL02838:Vps13d APN 4 144,801,595 (GRCm39) missense probably benign 0.31
IGL02968:Vps13d APN 4 144,849,068 (GRCm39) missense probably benign 0.32
IGL03176:Vps13d APN 4 144,801,533 (GRCm39) missense probably benign 0.16
IGL03352:Vps13d APN 4 144,894,072 (GRCm39) missense possibly damaging 0.49
IGL03374:Vps13d APN 4 144,835,145 (GRCm39) missense possibly damaging 0.70
IGL03375:Vps13d APN 4 144,818,517 (GRCm39) missense probably damaging 1.00
IGL03383:Vps13d APN 4 144,894,889 (GRCm39) critical splice acceptor site probably null
IGL03411:Vps13d APN 4 144,875,894 (GRCm39) missense probably damaging 1.00
broken UTSW 4 144,813,305 (GRCm39) missense
demotion UTSW 4 144,865,183 (GRCm39) missense
BB008:Vps13d UTSW 4 144,822,854 (GRCm39) nonsense probably null
BB018:Vps13d UTSW 4 144,822,854 (GRCm39) nonsense probably null
PIT4283001:Vps13d UTSW 4 144,835,158 (GRCm39) missense
PIT4434001:Vps13d UTSW 4 144,881,817 (GRCm39) missense
R0069:Vps13d UTSW 4 144,789,133 (GRCm39) missense probably benign 0.09
R0069:Vps13d UTSW 4 144,789,133 (GRCm39) missense probably benign 0.09
R0076:Vps13d UTSW 4 144,891,264 (GRCm39) splice site probably benign
R0211:Vps13d UTSW 4 144,841,348 (GRCm39) missense probably benign 0.08
R0219:Vps13d UTSW 4 144,832,479 (GRCm39) missense probably benign 0.01
R0284:Vps13d UTSW 4 144,871,372 (GRCm39) missense probably benign 0.01
R0345:Vps13d UTSW 4 144,844,195 (GRCm39) missense possibly damaging 0.81
R0400:Vps13d UTSW 4 144,792,397 (GRCm39) missense probably benign 0.00
R0417:Vps13d UTSW 4 144,703,130 (GRCm39) missense probably benign 0.19
R0538:Vps13d UTSW 4 144,771,665 (GRCm39) missense probably damaging 1.00
R0560:Vps13d UTSW 4 144,780,760 (GRCm39) missense probably damaging 1.00
R0627:Vps13d UTSW 4 144,813,754 (GRCm39) missense probably damaging 1.00
R0707:Vps13d UTSW 4 144,882,502 (GRCm39) missense probably damaging 1.00
R0782:Vps13d UTSW 4 144,853,195 (GRCm39) splice site probably benign
R0925:Vps13d UTSW 4 144,883,121 (GRCm39) missense probably damaging 1.00
R0993:Vps13d UTSW 4 144,844,262 (GRCm39) nonsense probably null
R1135:Vps13d UTSW 4 144,882,159 (GRCm39) missense probably benign 0.01
R1165:Vps13d UTSW 4 144,853,041 (GRCm39) missense probably benign
R1263:Vps13d UTSW 4 144,896,918 (GRCm39) missense probably benign 0.01
R1397:Vps13d UTSW 4 144,867,904 (GRCm39) missense probably damaging 1.00
R1398:Vps13d UTSW 4 144,826,553 (GRCm39) missense probably null
R1521:Vps13d UTSW 4 144,832,431 (GRCm39) missense probably benign 0.00
R1522:Vps13d UTSW 4 144,824,742 (GRCm39) splice site probably null
R1725:Vps13d UTSW 4 144,869,830 (GRCm39) missense possibly damaging 0.90
R1759:Vps13d UTSW 4 144,882,427 (GRCm39) missense probably benign
R1826:Vps13d UTSW 4 144,881,573 (GRCm39) missense probably damaging 0.96
R1900:Vps13d UTSW 4 144,853,176 (GRCm39) missense probably benign 0.23
R1943:Vps13d UTSW 4 144,882,427 (GRCm39) missense probably benign
R1955:Vps13d UTSW 4 144,882,713 (GRCm39) missense probably damaging 1.00
R2008:Vps13d UTSW 4 144,881,813 (GRCm39) missense probably benign 0.00
R2013:Vps13d UTSW 4 144,835,078 (GRCm39) missense probably damaging 0.99
R2014:Vps13d UTSW 4 144,835,078 (GRCm39) missense probably damaging 0.99
R2038:Vps13d UTSW 4 144,907,685 (GRCm39) critical splice donor site probably null
R2108:Vps13d UTSW 4 144,801,617 (GRCm39) missense probably damaging 0.99
R2130:Vps13d UTSW 4 144,882,671 (GRCm39) missense probably benign 0.17
R2134:Vps13d UTSW 4 144,874,909 (GRCm39) missense probably benign 0.00
R2168:Vps13d UTSW 4 144,813,893 (GRCm39) splice site probably benign
R2220:Vps13d UTSW 4 144,904,890 (GRCm39) missense probably damaging 1.00
R2240:Vps13d UTSW 4 144,837,465 (GRCm39) missense possibly damaging 0.70
R2332:Vps13d UTSW 4 144,875,256 (GRCm39) missense probably benign
R2357:Vps13d UTSW 4 144,801,547 (GRCm39) frame shift probably null
R2365:Vps13d UTSW 4 144,813,894 (GRCm39) splice site probably benign
R2571:Vps13d UTSW 4 144,875,706 (GRCm39) missense probably benign 0.20
R3149:Vps13d UTSW 4 144,853,147 (GRCm39) missense possibly damaging 0.70
R3150:Vps13d UTSW 4 144,813,360 (GRCm39) missense probably damaging 0.98
R3547:Vps13d UTSW 4 144,801,545 (GRCm39) missense probably damaging 0.99
R3716:Vps13d UTSW 4 144,802,296 (GRCm39) missense probably damaging 1.00
R3718:Vps13d UTSW 4 144,802,296 (GRCm39) missense probably damaging 1.00
R3725:Vps13d UTSW 4 144,842,218 (GRCm39) splice site probably benign
R3875:Vps13d UTSW 4 144,917,114 (GRCm39) missense probably damaging 1.00
R3948:Vps13d UTSW 4 144,867,910 (GRCm39) missense probably damaging 1.00
R3953:Vps13d UTSW 4 144,875,450 (GRCm39) missense probably damaging 1.00
R4021:Vps13d UTSW 4 144,801,631 (GRCm39) missense possibly damaging 0.90
R4323:Vps13d UTSW 4 144,879,348 (GRCm39) missense probably benign 0.28
R4346:Vps13d UTSW 4 144,799,099 (GRCm39) intron probably benign
R4509:Vps13d UTSW 4 144,789,172 (GRCm39) missense probably damaging 1.00
R4613:Vps13d UTSW 4 144,858,225 (GRCm39) missense possibly damaging 0.95
R4657:Vps13d UTSW 4 144,801,412 (GRCm39) missense probably damaging 1.00
R4680:Vps13d UTSW 4 144,835,080 (GRCm39) missense possibly damaging 0.94
R4688:Vps13d UTSW 4 144,904,782 (GRCm39) missense probably benign
R4797:Vps13d UTSW 4 144,780,725 (GRCm39) missense probably damaging 1.00
R4798:Vps13d UTSW 4 144,904,626 (GRCm39) missense probably damaging 0.98
R4817:Vps13d UTSW 4 144,795,735 (GRCm39) missense probably damaging 1.00
R4839:Vps13d UTSW 4 144,812,000 (GRCm39) missense possibly damaging 0.95
R4860:Vps13d UTSW 4 144,813,731 (GRCm39) missense probably benign
R4860:Vps13d UTSW 4 144,813,731 (GRCm39) missense probably benign
R4869:Vps13d UTSW 4 144,854,612 (GRCm39) missense probably damaging 1.00
R4904:Vps13d UTSW 4 144,882,015 (GRCm39) missense probably damaging 1.00
R4912:Vps13d UTSW 4 144,882,427 (GRCm39) missense probably benign
R4916:Vps13d UTSW 4 144,709,963 (GRCm39) missense probably damaging 1.00
R4976:Vps13d UTSW 4 144,832,468 (GRCm39) missense possibly damaging 0.82
R5029:Vps13d UTSW 4 144,882,852 (GRCm39) missense probably benign 0.02
R5049:Vps13d UTSW 4 144,813,336 (GRCm39) missense probably damaging 1.00
R5077:Vps13d UTSW 4 144,814,811 (GRCm39) missense probably damaging 0.98
R5119:Vps13d UTSW 4 144,832,468 (GRCm39) missense possibly damaging 0.82
R5227:Vps13d UTSW 4 144,907,777 (GRCm39) splice site probably null
R5291:Vps13d UTSW 4 144,789,139 (GRCm39) missense probably damaging 0.99
R5344:Vps13d UTSW 4 144,904,904 (GRCm39) missense probably damaging 0.98
R5348:Vps13d UTSW 4 144,792,459 (GRCm39) missense probably damaging 0.99
R5478:Vps13d UTSW 4 144,894,120 (GRCm39) missense probably damaging 0.99
R5632:Vps13d UTSW 4 144,801,452 (GRCm39) missense probably damaging 0.99
R5642:Vps13d UTSW 4 144,896,872 (GRCm39) missense possibly damaging 0.66
R5712:Vps13d UTSW 4 144,813,743 (GRCm39) missense probably benign 0.07
R5747:Vps13d UTSW 4 144,894,853 (GRCm39) missense probably benign 0.00
R5752:Vps13d UTSW 4 144,875,540 (GRCm39) missense probably benign 0.06
R5804:Vps13d UTSW 4 144,826,640 (GRCm39) missense probably benign 0.03
R5917:Vps13d UTSW 4 144,826,580 (GRCm39) missense probably damaging 0.96
R5932:Vps13d UTSW 4 144,771,611 (GRCm39) missense possibly damaging 0.71
R5940:Vps13d UTSW 4 144,801,545 (GRCm39) missense probably benign 0.09
R5978:Vps13d UTSW 4 144,849,181 (GRCm39) missense probably benign
R6031:Vps13d UTSW 4 144,895,079 (GRCm39) missense probably benign 0.01
R6031:Vps13d UTSW 4 144,895,079 (GRCm39) missense probably benign 0.01
R6143:Vps13d UTSW 4 144,875,135 (GRCm39) missense possibly damaging 0.95
R6174:Vps13d UTSW 4 144,701,763 (GRCm39) nonsense probably null
R6191:Vps13d UTSW 4 144,875,918 (GRCm39) missense probably damaging 1.00
R6198:Vps13d UTSW 4 144,875,560 (GRCm39) missense probably benign 0.28
R6374:Vps13d UTSW 4 144,849,251 (GRCm39) missense probably damaging 1.00
R6379:Vps13d UTSW 4 144,814,828 (GRCm39) missense probably benign
R6388:Vps13d UTSW 4 144,882,144 (GRCm39) missense probably benign 0.06
R6418:Vps13d UTSW 4 144,818,850 (GRCm39) missense probably damaging 0.98
R6466:Vps13d UTSW 4 144,784,065 (GRCm39) missense possibly damaging 0.47
R6602:Vps13d UTSW 4 144,830,234 (GRCm39) intron probably benign
R6604:Vps13d UTSW 4 144,907,694 (GRCm39) missense probably damaging 1.00
R7051:Vps13d UTSW 4 144,889,914 (GRCm39) missense probably benign 0.00
R7052:Vps13d UTSW 4 144,889,914 (GRCm39) missense probably benign 0.00
R7103:Vps13d UTSW 4 144,842,062 (GRCm39) missense
R7231:Vps13d UTSW 4 144,784,032 (GRCm39) missense
R7246:Vps13d UTSW 4 144,882,620 (GRCm39) missense
R7339:Vps13d UTSW 4 144,847,938 (GRCm39) missense
R7409:Vps13d UTSW 4 144,867,824 (GRCm39) missense
R7419:Vps13d UTSW 4 144,842,073 (GRCm39) missense
R7424:Vps13d UTSW 4 144,875,317 (GRCm39) missense
R7439:Vps13d UTSW 4 144,832,426 (GRCm39) missense
R7440:Vps13d UTSW 4 144,854,981 (GRCm39) missense
R7528:Vps13d UTSW 4 144,818,492 (GRCm39) missense
R7547:Vps13d UTSW 4 144,784,108 (GRCm39) missense
R7558:Vps13d UTSW 4 144,881,150 (GRCm39) missense
R7699:Vps13d UTSW 4 144,811,975 (GRCm39) missense
R7729:Vps13d UTSW 4 144,801,622 (GRCm39) missense
R7789:Vps13d UTSW 4 144,826,635 (GRCm39) missense
R7813:Vps13d UTSW 4 144,904,633 (GRCm39) nonsense probably null
R7834:Vps13d UTSW 4 144,835,143 (GRCm39) missense
R7840:Vps13d UTSW 4 144,830,246 (GRCm39) missense
R7880:Vps13d UTSW 4 144,907,684 (GRCm39) critical splice donor site probably null
R7912:Vps13d UTSW 4 144,899,697 (GRCm39) missense
R7915:Vps13d UTSW 4 144,813,389 (GRCm39) missense
R7931:Vps13d UTSW 4 144,822,854 (GRCm39) nonsense probably null
R8021:Vps13d UTSW 4 144,875,245 (GRCm39) missense
R8048:Vps13d UTSW 4 144,882,137 (GRCm39) missense
R8057:Vps13d UTSW 4 144,701,753 (GRCm39) missense
R8063:Vps13d UTSW 4 144,841,327 (GRCm39) missense
R8131:Vps13d UTSW 4 144,882,707 (GRCm39) missense
R8190:Vps13d UTSW 4 144,879,321 (GRCm39) missense
R8226:Vps13d UTSW 4 144,875,860 (GRCm39) missense
R8241:Vps13d UTSW 4 144,875,047 (GRCm39) missense
R8254:Vps13d UTSW 4 144,709,882 (GRCm39) splice site probably benign
R8305:Vps13d UTSW 4 144,818,858 (GRCm39) missense
R8415:Vps13d UTSW 4 144,818,549 (GRCm39) missense
R8460:Vps13d UTSW 4 144,897,009 (GRCm39) intron probably benign
R8487:Vps13d UTSW 4 144,881,817 (GRCm39) missense probably benign 0.11
R8543:Vps13d UTSW 4 144,743,353 (GRCm39) nonsense probably null
R8679:Vps13d UTSW 4 144,811,977 (GRCm39) missense
R8716:Vps13d UTSW 4 144,802,348 (GRCm39) missense
R8749:Vps13d UTSW 4 144,865,183 (GRCm39) missense
R8772:Vps13d UTSW 4 144,801,602 (GRCm39) missense
R8788:Vps13d UTSW 4 144,813,305 (GRCm39) missense
R8789:Vps13d UTSW 4 144,795,743 (GRCm39) missense
R8836:Vps13d UTSW 4 144,882,648 (GRCm39) missense
R8874:Vps13d UTSW 4 144,881,772 (GRCm39) missense
R8918:Vps13d UTSW 4 144,772,873 (GRCm39) missense
R9129:Vps13d UTSW 4 144,898,249 (GRCm39) missense
R9220:Vps13d UTSW 4 144,783,058 (GRCm39) missense
R9233:Vps13d UTSW 4 144,879,344 (GRCm39) missense
R9234:Vps13d UTSW 4 144,875,792 (GRCm39) missense
R9256:Vps13d UTSW 4 144,882,374 (GRCm39) missense
R9350:Vps13d UTSW 4 144,882,333 (GRCm39) missense
R9398:Vps13d UTSW 4 144,896,956 (GRCm39) nonsense probably null
R9415:Vps13d UTSW 4 144,796,527 (GRCm39) missense
R9438:Vps13d UTSW 4 144,858,314 (GRCm39) missense
R9469:Vps13d UTSW 4 144,780,691 (GRCm39) missense
R9487:Vps13d UTSW 4 144,807,869 (GRCm39) critical splice donor site probably null
R9524:Vps13d UTSW 4 144,822,814 (GRCm39) missense
R9616:Vps13d UTSW 4 144,824,701 (GRCm39) missense
R9655:Vps13d UTSW 4 144,813,305 (GRCm39) missense
R9709:Vps13d UTSW 4 144,875,915 (GRCm39) missense
R9767:Vps13d UTSW 4 144,879,306 (GRCm39) missense
R9773:Vps13d UTSW 4 144,818,619 (GRCm39) missense
R9779:Vps13d UTSW 4 144,798,972 (GRCm39) missense
R9796:Vps13d UTSW 4 144,854,505 (GRCm39) critical splice donor site probably null
X0021:Vps13d UTSW 4 144,881,595 (GRCm39) missense probably damaging 0.99
Z1176:Vps13d UTSW 4 144,833,637 (GRCm39) missense
Z1177:Vps13d UTSW 4 144,904,866 (GRCm39) missense
Z1177:Vps13d UTSW 4 144,881,478 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- ATTCACTTATGGAGGACTGGGG -3'
(R):5'- AGCTGCAGTTCTCATCACACTG -3'

Sequencing Primer
(F):5'- AATGGTCCCAAACTTCTCTGAG -3'
(R):5'- ACTGCTATGCTGTGGCTAC -3'
Posted On 2015-03-25