Mutagenetix > Incidental Mutation

Incidental Mutation 'R3795:Mrc1'

272709

Institutional Source

Beutler Lab

Gene Symbol

Mrc1

Ensembl Gene

ENSMUSG00000026712

Gene Name

mannose receptor, C type 1

Synonyms

CD206, MR

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.066) question?

Stock #

R3795 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

14234225-14336834 bp(+) (GRCm39)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 14293793 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000028045 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028045]

AlphaFold

Q61830

PDB Structure

CRYSTAL STRUCTURE OF THE CYSTEINE RICH DOMAIN OF MANNOSE RECEPTOR [X-RAY DIFFRACTION]
Crystal structure of the cysteine rich domain of mannose receptor complexed with Acetylgalactosamine-4-sulfate [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MANNOSE RECEPTOR COMPLEXED WITH 3-SO4-LEWIS(X) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MANNOSE RECEPTOR COMPLEXED WITH 3-SO4-LEWIS(A) [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000028045

SMART Domains

Protein: ENSMUSP00000028045
Gene: ENSMUSG00000026712

Domain	Start	End	E-Value	Type
RICIN	22	142	8.09e-18	SMART
FN2	161	209	1.83e-27	SMART
CLECT	216	341	8.87e-26	SMART
CLECT	362	487	3.51e-38	SMART
CLECT	504	626	8.2e-30	SMART
CLECT	646	778	2.34e-34	SMART
CLECT	800	923	2.17e-29	SMART
low complexity region	935	941	N/A	INTRINSIC
CLECT	944	1079	3.35e-35	SMART
CLECT	1094	1212	4.11e-21	SMART
CLECT	1229	1355	3.63e-31	SMART
transmembrane domain	1388	1410	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

97% (32/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The recognition of complex carbohydrate structures on glycoproteins is an important part of several biological processes, including cell-cell recognition, serum glycoprotein turnover, and neutralization of pathogens. The protein encoded by this gene is a type I membrane receptor that mediates the endocytosis of glycoproteins by macrophages. The protein has been shown to bind high-mannose structures on the surface of potentially pathogenic viruses, bacteria, and fungi so that they can be neutralized by phagocytic engulfment.[provided by RefSeq, Sep 2015]
PHENOTYPE: Male homozygotes for one targeted null mutation die in utero. Heterozygous females clear lutropin from the circulation more slowly and have smaller litters due to reduced implantation. Another targeted knockout is viable and homozygotes are less susceptible to parasitic infection. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb9	T	C	5: 124,228,212 (GRCm39)	T10A	probably benign	Het
Adh1	T	A	3: 137,985,526 (GRCm39)	L18H	possibly damaging	Het
Bltp1	A	G	3: 37,084,714 (GRCm39)	T426A	probably benign	Het
Capn13	C	A	17: 73,644,387 (GRCm39)	V381L	probably benign	Het
Cfap54	T	C	10: 92,778,735 (GRCm39)		probably benign	Het
Cmas	T	A	6: 142,713,594 (GRCm39)	D206E	probably benign	Het
Cntnap1	A	G	11: 101,077,590 (GRCm39)	E1084G	probably damaging	Het
Cpz	A	G	5: 35,669,093 (GRCm39)	V346A	probably benign	Het
Dhrs3	A	G	4: 144,645,962 (GRCm39)	D116G	probably damaging	Het
Efcab3	A	G	11: 104,624,501 (GRCm39)	E844G	possibly damaging	Het
Inpp4b	T	C	8: 82,759,845 (GRCm39)	V445A	probably damaging	Het
Katnip	A	G	7: 125,419,261 (GRCm39)	N476S	probably benign	Het
Lhx2	T	C	2: 38,243,359 (GRCm39)	C12R	probably damaging	Het
Map3k2	T	C	18: 32,359,701 (GRCm39)	M518T	probably benign	Het
Nlrp4e	T	A	7: 23,020,228 (GRCm39)	D238E	probably benign	Het
Obscn	A	G	11: 58,922,667 (GRCm39)	Y6543H	probably damaging	Het
Pigv	A	G	4: 133,392,502 (GRCm39)	S223P	possibly damaging	Het
Pkdcc	A	G	17: 83,531,382 (GRCm39)	T464A	probably damaging	Het
Polr2k	A	G	15: 36,175,193 (GRCm39)	I18V	probably damaging	Het
Psg20	A	G	7: 18,418,374 (GRCm39)	V131A	probably benign	Het
Ptpro	T	C	6: 137,357,307 (GRCm39)	F266S	probably benign	Het
S100a7l2	T	C	3: 90,995,730 (GRCm39)	I57M	possibly damaging	Het
Sdk2	G	A	11: 113,747,522 (GRCm39)	R663*	probably null	Het
Szt2	G	T	4: 118,248,927 (GRCm39)	L586I	probably damaging	Het
Tln2	T	C	9: 67,163,197 (GRCm39)	I1113V	probably damaging	Het
Ube2ql1	G	T	13: 69,852,231 (GRCm39)	A282E	possibly damaging	Het
Vmn2r50	T	A	7: 9,771,851 (GRCm39)	M617L	probably benign	Het
Wdfy3	A	G	5: 102,085,466 (GRCm39)	V676A	probably damaging	Het
Wdr47	T	C	3: 108,532,053 (GRCm39)		probably null	Het
Zbp1	T	C	2: 173,053,972 (GRCm39)	H183R	probably benign	Het
Zfp352	C	T	4: 90,113,386 (GRCm39)	H509Y	probably damaging	Het
Zfp988	G	A	4: 147,416,040 (GRCm39)	R158Q	possibly damaging	Het

Other mutations in Mrc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01013:Mrc1	APN	2	14,333,236 (GRCm39)	missense	probably damaging	1.00
IGL01326:Mrc1	APN	2	14,271,335 (GRCm39)	missense	probably damaging	1.00
IGL01340:Mrc1	APN	2	14,314,895 (GRCm39)	critical splice donor site	probably null
IGL01758:Mrc1	APN	2	14,243,059 (GRCm39)	missense	probably damaging	1.00
IGL01799:Mrc1	APN	2	14,243,187 (GRCm39)	missense	probably damaging	1.00
IGL02280:Mrc1	APN	2	14,249,024 (GRCm39)	missense	probably benign	0.19
IGL02435:Mrc1	APN	2	14,253,671 (GRCm39)	nonsense	probably null
IGL03073:Mrc1	APN	2	14,310,153 (GRCm39)	missense	probably damaging	1.00
IGL03110:Mrc1	APN	2	14,298,289 (GRCm39)	nonsense	probably null
IGL03155:Mrc1	APN	2	14,335,912 (GRCm39)	missense	probably benign	0.00
IGL03289:Mrc1	APN	2	14,313,634 (GRCm39)	critical splice donor site	probably null
amlodipine	UTSW	2	14,275,016 (GRCm39)	missense	probably damaging	1.00
losartan	UTSW	2	14,299,597 (GRCm39)	splice site	probably null
Shug	UTSW	2	14,275,017 (GRCm39)	missense	probably damaging	1.00
sussigkeit	UTSW	2	14,330,192 (GRCm39)	splice site	probably null
R0011:Mrc1	UTSW	2	14,266,148 (GRCm39)	critical splice donor site	probably null
R0011:Mrc1	UTSW	2	14,266,148 (GRCm39)	critical splice donor site	probably null
R0066:Mrc1	UTSW	2	14,266,011 (GRCm39)	missense	probably benign	0.42
R0066:Mrc1	UTSW	2	14,266,011 (GRCm39)	missense	probably benign	0.42
R0110:Mrc1	UTSW	2	14,243,353 (GRCm39)	splice site	probably benign
R0234:Mrc1	UTSW	2	14,284,705 (GRCm39)	missense	possibly damaging	0.65
R0234:Mrc1	UTSW	2	14,284,705 (GRCm39)	missense	possibly damaging	0.65
R0381:Mrc1	UTSW	2	14,312,720 (GRCm39)	missense	probably benign	0.05
R0505:Mrc1	UTSW	2	14,314,843 (GRCm39)	missense	probably damaging	1.00
R0539:Mrc1	UTSW	2	14,274,937 (GRCm39)	splice site	probably benign
R0613:Mrc1	UTSW	2	14,299,630 (GRCm39)	missense	probably damaging	0.96
R0626:Mrc1	UTSW	2	14,333,382 (GRCm39)	nonsense	probably null
R1122:Mrc1	UTSW	2	14,266,147 (GRCm39)	critical splice donor site	probably null
R1281:Mrc1	UTSW	2	14,298,321 (GRCm39)	missense	probably damaging	1.00
R1399:Mrc1	UTSW	2	14,284,736 (GRCm39)	missense	probably damaging	1.00
R1428:Mrc1	UTSW	2	14,320,074 (GRCm39)	missense	probably benign	0.11
R1571:Mrc1	UTSW	2	14,313,544 (GRCm39)	missense	probably damaging	0.97
R1596:Mrc1	UTSW	2	14,253,701 (GRCm39)	missense	possibly damaging	0.91
R1730:Mrc1	UTSW	2	14,332,655 (GRCm39)	missense	probably benign	0.01
R1733:Mrc1	UTSW	2	14,261,910 (GRCm39)	missense	probably damaging	1.00
R1783:Mrc1	UTSW	2	14,332,655 (GRCm39)	missense	probably benign	0.01
R1860:Mrc1	UTSW	2	14,333,390 (GRCm39)	missense	probably benign	0.30
R1872:Mrc1	UTSW	2	14,330,192 (GRCm39)	splice site	probably null
R1889:Mrc1	UTSW	2	14,313,488 (GRCm39)	critical splice acceptor site	probably null
R1938:Mrc1	UTSW	2	14,324,052 (GRCm39)	missense	possibly damaging	0.89
R1971:Mrc1	UTSW	2	14,249,103 (GRCm39)	critical splice donor site	probably null
R2031:Mrc1	UTSW	2	14,326,584 (GRCm39)	missense	probably damaging	1.00
R2136:Mrc1	UTSW	2	14,275,000 (GRCm39)	missense	probably damaging	1.00
R2152:Mrc1	UTSW	2	14,332,675 (GRCm39)	missense	probably damaging	1.00
R2168:Mrc1	UTSW	2	14,249,015 (GRCm39)	missense	possibly damaging	0.90
R2273:Mrc1	UTSW	2	14,330,183 (GRCm39)	missense	probably damaging	1.00
R2901:Mrc1	UTSW	2	14,333,354 (GRCm39)	missense	possibly damaging	0.94
R3767:Mrc1	UTSW	2	14,323,981 (GRCm39)	missense	probably damaging	1.00
R4028:Mrc1	UTSW	2	14,243,059 (GRCm39)	missense	probably damaging	1.00
R4668:Mrc1	UTSW	2	14,298,297 (GRCm39)	missense	probably damaging	1.00
R4828:Mrc1	UTSW	2	14,275,017 (GRCm39)	missense	probably damaging	1.00
R4897:Mrc1	UTSW	2	14,323,952 (GRCm39)	missense	probably benign	0.01
R4950:Mrc1	UTSW	2	14,276,091 (GRCm39)	missense	probably damaging	1.00
R5000:Mrc1	UTSW	2	14,249,000 (GRCm39)	missense	probably damaging	1.00
R5068:Mrc1	UTSW	2	14,311,327 (GRCm39)	missense	probably benign	0.00
R5279:Mrc1	UTSW	2	14,314,869 (GRCm39)	missense	probably damaging	0.99
R5366:Mrc1	UTSW	2	14,326,725 (GRCm39)	missense	probably benign	0.03
R5436:Mrc1	UTSW	2	14,271,326 (GRCm39)	missense	probably damaging	1.00
R5552:Mrc1	UTSW	2	14,284,768 (GRCm39)	missense	probably benign	0.05
R5631:Mrc1	UTSW	2	14,333,383 (GRCm39)	nonsense	probably null
R5831:Mrc1	UTSW	2	14,313,523 (GRCm39)	missense	probably damaging	0.99
R5978:Mrc1	UTSW	2	14,320,204 (GRCm39)	missense	probably damaging	0.97
R5993:Mrc1	UTSW	2	14,310,138 (GRCm39)	missense	probably damaging	1.00
R6030:Mrc1	UTSW	2	14,321,712 (GRCm39)	missense	probably benign	0.04
R6030:Mrc1	UTSW	2	14,321,712 (GRCm39)	missense	probably benign	0.04
R6038:Mrc1	UTSW	2	14,261,882 (GRCm39)	missense	probably damaging	1.00
R6038:Mrc1	UTSW	2	14,261,882 (GRCm39)	missense	probably damaging	1.00
R6228:Mrc1	UTSW	2	14,276,115 (GRCm39)	missense	probably benign	0.08
R6344:Mrc1	UTSW	2	14,248,985 (GRCm39)	missense	probably damaging	1.00
R6457:Mrc1	UTSW	2	14,275,016 (GRCm39)	missense	probably damaging	1.00
R6520:Mrc1	UTSW	2	14,312,760 (GRCm39)	missense	probably damaging	1.00
R6619:Mrc1	UTSW	2	14,299,597 (GRCm39)	splice site	probably null
R6631:Mrc1	UTSW	2	14,243,296 (GRCm39)	missense	probably benign
R6737:Mrc1	UTSW	2	14,276,088 (GRCm39)	missense	possibly damaging	0.95
R6782:Mrc1	UTSW	2	14,266,148 (GRCm39)	critical splice donor site	probably null
R6887:Mrc1	UTSW	2	14,330,048 (GRCm39)	missense	possibly damaging	0.94
R7108:Mrc1	UTSW	2	14,308,957 (GRCm39)	nonsense	probably null
R7120:Mrc1	UTSW	2	14,313,508 (GRCm39)	missense	probably damaging	0.97
R7460:Mrc1	UTSW	2	14,253,680 (GRCm39)	missense	probably damaging	1.00
R7567:Mrc1	UTSW	2	14,330,104 (GRCm39)	missense	probably damaging	1.00
R7606:Mrc1	UTSW	2	14,242,955 (GRCm39)	missense	probably damaging	1.00
R7725:Mrc1	UTSW	2	14,284,788 (GRCm39)	missense	probably benign	0.03
R7826:Mrc1	UTSW	2	14,299,668 (GRCm39)	missense	probably damaging	1.00
R8082:Mrc1	UTSW	2	14,253,771 (GRCm39)	missense	probably benign
R8279:Mrc1	UTSW	2	14,271,168 (GRCm39)	missense	possibly damaging	0.89
R8888:Mrc1	UTSW	2	14,312,760 (GRCm39)	missense	probably damaging	1.00
R8895:Mrc1	UTSW	2	14,312,760 (GRCm39)	missense	probably damaging	1.00
R8952:Mrc1	UTSW	2	14,253,735 (GRCm39)	missense	probably damaging	0.98
R9315:Mrc1	UTSW	2	14,248,969 (GRCm39)	nonsense	probably null
R9366:Mrc1	UTSW	2	14,321,709 (GRCm39)	missense	probably damaging	0.99
R9373:Mrc1	UTSW	2	14,274,999 (GRCm39)	missense	probably damaging	0.99
R9418:Mrc1	UTSW	2	14,234,358 (GRCm39)	missense	probably benign	0.12
R9420:Mrc1	UTSW	2	14,312,790 (GRCm39)	missense	possibly damaging	0.53
R9489:Mrc1	UTSW	2	14,324,110 (GRCm39)	missense	probably benign	0.06
R9564:Mrc1	UTSW	2	14,266,117 (GRCm39)	missense	probably benign	0.00
R9572:Mrc1	UTSW	2	14,234,334 (GRCm39)	missense	probably benign
R9605:Mrc1	UTSW	2	14,324,110 (GRCm39)	missense	probably benign	0.06
R9606:Mrc1	UTSW	2	14,313,517 (GRCm39)	missense	probably benign	0.01
R9781:Mrc1	UTSW	2	14,310,175 (GRCm39)	missense	possibly damaging	0.90
R9781:Mrc1	UTSW	2	14,249,100 (GRCm39)	missense	probably benign
Z1177:Mrc1	UTSW	2	14,293,927 (GRCm39)	missense	probably damaging	1.00
Z1177:Mrc1	UTSW	2	14,248,949 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTGTTCAGACTAATTTCCTAAGTTCG -3'
(R):5'- AATTTGGCGAGTGATCCTTACTTTG -3'

Sequencing Primer
(F):5'- AGACTAATTTCCTAAGTTCGGCGGG -3'
(R):5'- GGCGAGTGATCCTTACTTTGAAACAC -3'

Posted On

2015-03-25