Incidental Mutation 'R3795:Cntnap1'
ID272737
Institutional Source Beutler Lab
Gene Symbol Cntnap1
Ensembl Gene ENSMUSG00000017167
Gene Namecontactin associated protein-like 1
SynonymsNrxn4, Caspr, NCP1, p190, paranodin, shm
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.519) question?
Stock #R3795 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location101170523-101190724 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101186764 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1084 (E1084G)
Ref Sequence ENSEMBL: ENSMUSP00000099398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103109] [ENSMUST00000107284] [ENSMUST00000107285]
Predicted Effect probably damaging
Transcript: ENSMUST00000103109
AA Change: E1084G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099398
Gene: ENSMUSG00000017167
AA Change: E1084G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
FA58C 25 169 7.49e-36 SMART
LamG 196 333 2.86e-32 SMART
LamG 382 516 3.49e-27 SMART
EGF 544 578 2.28e0 SMART
Blast:FBG 580 777 1e-133 BLAST
LamG 806 940 1.95e-25 SMART
EGF_like 961 997 6.03e1 SMART
low complexity region 1032 1044 N/A INTRINSIC
low complexity region 1047 1058 N/A INTRINSIC
low complexity region 1063 1078 N/A INTRINSIC
LamG 1081 1219 2.59e-30 SMART
4.1m 1305 1323 7.85e-7 SMART
low complexity region 1333 1370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107284
SMART Domains Protein: ENSMUSP00000102905
Gene: ENSMUSG00000006920

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 39 68 4.5e-21 PFAM
SANT 135 263 3.86e1 SMART
low complexity region 369 381 N/A INTRINSIC
SANT 430 478 3.03e-4 SMART
CXC 556 593 8.14e-2 SMART
SET 613 734 7.34e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107285
SMART Domains Protein: ENSMUSP00000102906
Gene: ENSMUSG00000006920

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 42 71 5.1e-20 PFAM
SANT 138 266 3.86e1 SMART
low complexity region 372 384 N/A INTRINSIC
SANT 433 481 3.03e-4 SMART
CXC 559 596 8.14e-2 SMART
SET 616 737 7.34e-39 SMART
Meta Mutation Damage Score 0.23 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene product was initially identified as a 190-kD protein associated with the contactin-PTPRZ1 complex. The 1,384-amino acid protein, also designated p190 or CASPR for 'contactin-associated protein,' includes an extracellular domain with several putative protein-protein interaction domains, a putative transmembrane domain, and a 74-amino acid cytoplasmic domain. Northern blot analysis showed that the gene is transcribed predominantly in brain as a transcript of 6.2 kb, with weak expression in several other tissues tested. The architecture of its extracellular domain is similar to that of neurexins, and this protein may be the signaling subunit of contactin, enabling recruitment and activation of intracellular signaling pathways in neurons. [provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygous mutant mice exhibit reduced body size and nervous system defects, including impaired balance, hypoactivity, and ataxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,030,565 T426A probably benign Het
9130204L05Rik T C 3: 91,088,423 I57M possibly damaging Het
Abcb9 T C 5: 124,090,149 T10A probably benign Het
Adh1 T A 3: 138,279,765 L18H possibly damaging Het
Capn13 C A 17: 73,337,392 V381L probably benign Het
Cfap54 T C 10: 92,942,873 probably benign Het
Cmas T A 6: 142,767,868 D206E probably benign Het
Cpz A G 5: 35,511,749 V346A probably benign Het
D430042O09Rik A G 7: 125,820,089 N476S probably benign Het
Dhrs3 A G 4: 144,919,392 D116G probably damaging Het
Gm11639 A G 11: 104,733,675 E844G possibly damaging Het
Inpp4b T C 8: 82,033,216 V445A probably damaging Het
Lhx2 T C 2: 38,353,347 C12R probably damaging Het
Map3k2 T C 18: 32,226,648 M518T probably benign Het
Mrc1 T A 2: 14,288,982 probably benign Het
Nlrp4e T A 7: 23,320,803 D238E probably benign Het
Obscn A G 11: 59,031,841 Y6543H probably damaging Het
Pigv A G 4: 133,665,191 S223P possibly damaging Het
Pkdcc A G 17: 83,223,953 T464A probably damaging Het
Polr2k A G 15: 36,175,047 I18V probably damaging Het
Psg20 A G 7: 18,684,449 V131A probably benign Het
Ptpro T C 6: 137,380,309 F266S probably benign Het
Sdk2 G A 11: 113,856,696 R663* probably null Het
Szt2 G T 4: 118,391,730 L586I probably damaging Het
Tln2 T C 9: 67,255,915 I1113V probably damaging Het
Ube2ql1 G T 13: 69,704,112 A282E possibly damaging Het
Vmn2r50 T A 7: 10,037,924 M617L probably benign Het
Wdfy3 A G 5: 101,937,600 V676A probably damaging Het
Wdr47 T C 3: 108,624,737 probably null Het
Zbp1 T C 2: 173,212,179 H183R probably benign Het
Zfp352 C T 4: 90,225,149 H509Y probably damaging Het
Zfp988 G A 4: 147,331,583 R158Q possibly damaging Het
Other mutations in Cntnap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Cntnap1 APN 11 101185092 missense possibly damaging 0.63
IGL00715:Cntnap1 APN 11 101183205 splice site probably benign
IGL00792:Cntnap1 APN 11 101178966 missense probably benign 0.19
IGL01063:Cntnap1 APN 11 101181788 missense probably benign 0.00
IGL01141:Cntnap1 APN 11 101178807 splice site probably benign
IGL02184:Cntnap1 APN 11 101178365 missense probably damaging 0.98
IGL02272:Cntnap1 APN 11 101178316 missense probably damaging 0.99
IGL02281:Cntnap1 APN 11 101182254 missense possibly damaging 0.86
IGL02437:Cntnap1 APN 11 101186851 missense probably damaging 1.00
IGL02456:Cntnap1 APN 11 101178129 missense probably benign 0.31
IGL02966:Cntnap1 APN 11 101184749 missense probably damaging 1.00
IGL03126:Cntnap1 APN 11 101176301 missense probably benign 0.00
IGL03294:Cntnap1 APN 11 101181682 missense possibly damaging 0.94
Penny UTSW 11 101186764 missense probably damaging 0.99
FR4304:Cntnap1 UTSW 11 101189581 unclassified probably benign
FR4304:Cntnap1 UTSW 11 101189589 unclassified probably benign
FR4342:Cntnap1 UTSW 11 101189575 unclassified probably benign
FR4449:Cntnap1 UTSW 11 101189569 unclassified probably benign
FR4449:Cntnap1 UTSW 11 101189593 unclassified probably benign
FR4548:Cntnap1 UTSW 11 101189572 unclassified probably benign
FR4548:Cntnap1 UTSW 11 101189579 unclassified probably benign
FR4548:Cntnap1 UTSW 11 101189593 unclassified probably benign
FR4548:Cntnap1 UTSW 11 101189594 unclassified probably benign
FR4589:Cntnap1 UTSW 11 101189566 unclassified probably benign
FR4589:Cntnap1 UTSW 11 101189575 unclassified probably benign
FR4589:Cntnap1 UTSW 11 101189580 unclassified probably benign
FR4589:Cntnap1 UTSW 11 101189581 unclassified probably benign
FR4737:Cntnap1 UTSW 11 101189569 unclassified probably benign
FR4737:Cntnap1 UTSW 11 101189576 unclassified probably benign
FR4737:Cntnap1 UTSW 11 101189582 unclassified probably benign
FR4737:Cntnap1 UTSW 11 101189590 unclassified probably benign
FR4976:Cntnap1 UTSW 11 101189569 unclassified probably benign
FR4976:Cntnap1 UTSW 11 101189572 unclassified probably benign
FR4976:Cntnap1 UTSW 11 101189585 unclassified probably benign
FR4976:Cntnap1 UTSW 11 101189588 unclassified probably benign
R0329:Cntnap1 UTSW 11 101188309 missense probably damaging 1.00
R0556:Cntnap1 UTSW 11 101183996 missense probably benign
R0586:Cntnap1 UTSW 11 101187014 missense probably damaging 0.97
R0635:Cntnap1 UTSW 11 101183459 missense probably benign 0.05
R0789:Cntnap1 UTSW 11 101181384 splice site probably benign
R1016:Cntnap1 UTSW 11 101177507 missense probably damaging 0.99
R1085:Cntnap1 UTSW 11 101178836 missense probably benign 0.02
R1211:Cntnap1 UTSW 11 101184710 missense probably damaging 1.00
R1466:Cntnap1 UTSW 11 101180360 missense probably damaging 1.00
R1466:Cntnap1 UTSW 11 101180360 missense probably damaging 1.00
R1584:Cntnap1 UTSW 11 101180360 missense probably damaging 1.00
R1689:Cntnap1 UTSW 11 101188873 unclassified probably null
R1758:Cntnap1 UTSW 11 101184623 missense probably damaging 1.00
R1779:Cntnap1 UTSW 11 101186511 missense probably damaging 0.99
R1964:Cntnap1 UTSW 11 101178024 nonsense probably null
R1966:Cntnap1 UTSW 11 101180386 missense possibly damaging 0.89
R2070:Cntnap1 UTSW 11 101182979 missense probably damaging 1.00
R2088:Cntnap1 UTSW 11 101182547 missense probably damaging 1.00
R2118:Cntnap1 UTSW 11 101188657 missense probably benign
R4375:Cntnap1 UTSW 11 101182253 missense probably damaging 1.00
R4779:Cntnap1 UTSW 11 101178072 missense possibly damaging 0.91
R4832:Cntnap1 UTSW 11 101183019 missense probably damaging 1.00
R4965:Cntnap1 UTSW 11 101177425 missense possibly damaging 0.52
R4981:Cntnap1 UTSW 11 101176333 splice site probably null
R5008:Cntnap1 UTSW 11 101188741 nonsense probably null
R5399:Cntnap1 UTSW 11 101183316 missense probably benign
R5507:Cntnap1 UTSW 11 101183477 missense probably benign 0.42
R5560:Cntnap1 UTSW 11 101182435 missense probably damaging 1.00
R5589:Cntnap1 UTSW 11 101185118 missense probably benign
R6038:Cntnap1 UTSW 11 101184636 missense probably benign 0.12
R6038:Cntnap1 UTSW 11 101184636 missense probably benign 0.12
R6242:Cntnap1 UTSW 11 101182538 missense probably damaging 1.00
R6306:Cntnap1 UTSW 11 101184615 missense probably damaging 1.00
R6392:Cntnap1 UTSW 11 101186646 missense probably damaging 1.00
R6803:Cntnap1 UTSW 11 101177234 missense possibly damaging 0.81
R6939:Cntnap1 UTSW 11 101186511 missense probably damaging 0.99
R6944:Cntnap1 UTSW 11 101182904 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGGATGCGCTATAACCTCCAG -3'
(R):5'- CGTCTAAAGGACTGGATCTTTGC -3'

Sequencing Primer
(F):5'- GAGTTCTCACACATGCTGAGC -3'
(R):5'- CATTAGTCAATCTCTGTGGGAGCC -3'
Posted On2015-03-25