Incidental Mutation 'R3797:B4galt1'
ID272788
Institutional Source Beutler Lab
Gene Symbol B4galt1
Ensembl Gene ENSMUSG00000028413
Gene NameUDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1
SynonymsGalT, Ggtb, beta 1,4-Galactosyltransferase I, Ggtb2, beta-1,4-GalT1, b1,4-Galactosyltransferase I, B-1,4-GalT1
MMRRC Submission 040758-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3797 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location40804602-40854005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 40807258 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 376 (T376I)
Ref Sequence ENSEMBL: ENSMUSP00000030121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030121] [ENSMUST00000108096]
Predicted Effect probably benign
Transcript: ENSMUST00000030121
AA Change: T376I

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000030121
Gene: ENSMUSG00000028413
AA Change: T376I

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 73 89 N/A INTRINSIC
Pfam:Glyco_transf_7N 131 264 3.1e-62 PFAM
Pfam:Glyco_transf_7C 268 346 5.9e-32 PFAM
Pfam:Glyco_tranf_2_2 279 339 4.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108096
SMART Domains Protein: ENSMUSP00000103731
Gene: ENSMUSG00000028413

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 73 89 N/A INTRINSIC
Pfam:Glyco_transf_7N 131 266 1.8e-52 PFAM
Pfam:Glyco_transf_7C 268 328 8.7e-26 PFAM
Meta Mutation Damage Score 0.046 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: This gene encodes two distinct enzyme isoforms, a long membrane-bound form and a short soluble form. These alternate isoforms are thought to be produced through alternative nested transcription initiation and different in-frame start codon usage. These enzymes catalyze the transfer of galactose to acceptor sugars, such as N-acetylglucosamine and glucose. The long form of this enzyme is localized to the trans-Golgi membrane and is involved in glycoconjugate biosynthesis. The short form functions in lactose biosynthesis though formation of a heterodimer with alpha-lactalbumin. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygotes for targeted null mutations exhibit growth retardation, low viability, excessive epithelial cell proliferation of skin and small intestine, sperm with reduced fertilizing capacity, birthing difficulty, and mammary gland defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 T C 5: 30,196,823 I736V possibly damaging Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
Basp1 C A 15: 25,364,312 probably benign Het
Capn5 C T 7: 98,125,829 G535R probably null Het
Ccdc170 G A 10: 4,560,920 V660I possibly damaging Het
Cdc73 A T 1: 143,677,723 D215E probably benign Het
Clec14a G A 12: 58,267,909 A309V probably benign Het
Clns1a G A 7: 97,696,835 G36R probably benign Het
Cops7a C T 6: 124,959,832 R252H probably damaging Het
Csmd2 C T 4: 128,517,595 P2469S probably benign Het
Dsp T A 13: 38,177,284 probably null Het
Eif3d A G 15: 77,968,569 F4S probably damaging Het
Ephb1 T C 9: 101,971,267 T611A probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fgfr1 G A 8: 25,572,437 D663N probably damaging Het
Gm5592 G A 7: 41,157,835 probably benign Het
Itgb8 T C 12: 119,163,469 I683M possibly damaging Het
Kcnip3 A G 2: 127,482,014 S32P probably benign Het
Limch1 A G 5: 66,969,079 T8A probably damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Ltbp1 A G 17: 75,362,630 Q1455R probably damaging Het
Marc2 T C 1: 184,841,308 E131G possibly damaging Het
Olfr620 C T 7: 103,611,447 R302Q probably benign Het
Pak7 T C 2: 136,100,826 I465V probably benign Het
Pcdhgb8 T C 18: 37,762,675 I266T probably benign Het
Pde4d T C 13: 109,632,897 S40P probably benign Het
Phrf1 C T 7: 141,259,918 R243* probably null Het
Polk A T 13: 96,486,982 probably benign Het
Ppl T C 16: 5,104,550 probably benign Het
Rab11fip3 A G 17: 26,068,526 C218R possibly damaging Het
Setd2 T C 9: 110,549,571 V818A probably benign Het
Skida1 C A 2: 18,045,897 E815* probably null Het
Slc35g3 A G 11: 69,760,917 F103L probably benign Het
Svil T A 18: 5,060,534 C802S probably benign Het
Trim7 A G 11: 48,845,670 probably null Het
Ugt3a1 G A 15: 9,310,641 W336* probably null Het
Vmn2r72 T C 7: 85,738,077 S760G probably benign Het
Vps13a T C 19: 16,745,947 probably null Het
Wdfy4 A T 14: 33,140,645 I590N probably damaging Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Xpnpep1 A T 19: 53,006,342 V285D probably benign Het
Zfp934 T C 13: 62,517,888 K313R probably benign Het
Other mutations in B4galt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01795:B4galt1 APN 4 40807760 missense probably damaging 1.00
periwinkle UTSW 4 40807760 missense probably damaging 1.00
R1589:B4galt1 UTSW 4 40823575 missense probably benign 0.28
R4419:B4galt1 UTSW 4 40853537 missense probably benign
R4703:B4galt1 UTSW 4 40823569 missense probably benign 0.14
R4727:B4galt1 UTSW 4 40807812 missense probably damaging 1.00
R5706:B4galt1 UTSW 4 40807268 missense probably damaging 0.97
R5903:B4galt1 UTSW 4 40807760 missense probably damaging 1.00
R6860:B4galt1 UTSW 4 40807796 missense probably benign 0.00
R6878:B4galt1 UTSW 4 40809694 missense probably damaging 1.00
R6943:B4galt1 UTSW 4 40812860 missense probably benign 0.00
R7239:B4galt1 UTSW 4 40812754 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACGTCTGAATGATAAGAAGAACTGTC -3'
(R):5'- TGCACAGGGCCCTTTAACTC -3'

Sequencing Primer
(F):5'- TCATTCAGACTGTACAAATGAGAGG -3'
(R):5'- GGCCCTTTAACTCCAGTGAAGTAG -3'
Posted On2015-03-25