Incidental Mutation 'R3797:Clns1a'
ID272796
Institutional Source Beutler Lab
Gene Symbol Clns1a
Ensembl Gene ENSMUSG00000025439
Gene Namechloride channel, nucleotide-sensitive, 1A
SynonymsClci, ICLN, Clcni, 2610100O04Rik, 2610036D06Rik
MMRRC Submission 040758-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3797 (G1)
Quality Score179
Status Validated
Chromosome7
Chromosomal Location97696634-97720796 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 97696835 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 36 (G36R)
Ref Sequence ENSEMBL: ENSMUSP00000026506 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026506] [ENSMUST00000107153]
Predicted Effect probably benign
Transcript: ENSMUST00000026506
AA Change: G36R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000026506
Gene: ENSMUSG00000025439
AA Change: G36R

DomainStartEndE-ValueType
Pfam:Voldacs 40 168 1.2e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107153
SMART Domains Protein: ENSMUSP00000102771
Gene: ENSMUSG00000035623

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
Pfam:WHIM1 88 138 2.2e-10 PFAM
Pfam:WHIM2 140 172 9.4e-8 PFAM
Pfam:WHIM3 178 398 2.5e-27 PFAM
low complexity region 743 758 N/A INTRINSIC
low complexity region 845 859 N/A INTRINSIC
low complexity region 863 872 N/A INTRINSIC
PHD 881 927 1.57e-11 SMART
low complexity region 945 959 N/A INTRINSIC
low complexity region 971 993 N/A INTRINSIC
low complexity region 1011 1030 N/A INTRINSIC
low complexity region 1072 1096 N/A INTRINSIC
low complexity region 1110 1128 N/A INTRINSIC
low complexity region 1133 1152 N/A INTRINSIC
low complexity region 1160 1190 N/A INTRINSIC
low complexity region 1192 1198 N/A INTRINSIC
low complexity region 1234 1248 N/A INTRINSIC
low complexity region 1268 1280 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141549
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147690
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155074
Meta Mutation Damage Score 0.0792 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions in multiple regulatory pathways. The encoded protein complexes with numerous cytosolic proteins and performs diverse functions including regulation of small nuclear ribonucleoprotein biosynthesis, platelet activation and cytoskeletal organization. The protein is also found associated with the plasma membrane where it functions as a chloride current regulator. Pseudogenes of this gene are found on chromosomes 1, 4 and 6. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2015]
PHENOTYPE: Homozygous mutants die between E3.5-E7.5. Heterozygous mutants appear normal and healthy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 T C 5: 30,196,823 I736V possibly damaging Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
B4galt1 G A 4: 40,807,258 T376I probably benign Het
Basp1 C A 15: 25,364,312 probably benign Het
Capn5 C T 7: 98,125,829 G535R probably null Het
Ccdc170 G A 10: 4,560,920 V660I possibly damaging Het
Cdc73 A T 1: 143,677,723 D215E probably benign Het
Clec14a G A 12: 58,267,909 A309V probably benign Het
Cops7a C T 6: 124,959,832 R252H probably damaging Het
Csmd2 C T 4: 128,517,595 P2469S probably benign Het
Dsp T A 13: 38,177,284 probably null Het
Eif3d A G 15: 77,968,569 F4S probably damaging Het
Ephb1 T C 9: 101,971,267 T611A probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fgfr1 G A 8: 25,572,437 D663N probably damaging Het
Gm5592 G A 7: 41,157,835 probably benign Het
Itgb8 T C 12: 119,163,469 I683M possibly damaging Het
Kcnip3 A G 2: 127,482,014 S32P probably benign Het
Limch1 A G 5: 66,969,079 T8A probably damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Ltbp1 A G 17: 75,362,630 Q1455R probably damaging Het
Marc2 T C 1: 184,841,308 E131G possibly damaging Het
Olfr620 C T 7: 103,611,447 R302Q probably benign Het
Pak7 T C 2: 136,100,826 I465V probably benign Het
Pcdhgb8 T C 18: 37,762,675 I266T probably benign Het
Pde4d T C 13: 109,632,897 S40P probably benign Het
Phrf1 C T 7: 141,259,918 R243* probably null Het
Polk A T 13: 96,486,982 probably benign Het
Ppl T C 16: 5,104,550 probably benign Het
Rab11fip3 A G 17: 26,068,526 C218R possibly damaging Het
Setd2 T C 9: 110,549,571 V818A probably benign Het
Skida1 C A 2: 18,045,897 E815* probably null Het
Slc35g3 A G 11: 69,760,917 F103L probably benign Het
Svil T A 18: 5,060,534 C802S probably benign Het
Trim7 A G 11: 48,845,670 probably null Het
Ugt3a1 G A 15: 9,310,641 W336* probably null Het
Vmn2r72 T C 7: 85,738,077 S760G probably benign Het
Vps13a T C 19: 16,745,947 probably null Het
Wdfy4 A T 14: 33,140,645 I590N probably damaging Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Xpnpep1 A T 19: 53,006,342 V285D probably benign Het
Zfp934 T C 13: 62,517,888 K313R probably benign Het
Other mutations in Clns1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00808:Clns1a APN 7 97716514 missense probably damaging 0.99
IGL03209:Clns1a APN 7 97711730 missense probably null 0.05
R0234:Clns1a UTSW 7 97714032 missense possibly damaging 0.93
R0234:Clns1a UTSW 7 97714032 missense possibly damaging 0.93
R1087:Clns1a UTSW 7 97705655 missense possibly damaging 0.63
R1844:Clns1a UTSW 7 97696859 missense probably damaging 0.97
R2119:Clns1a UTSW 7 97713904 splice site probably null
R4463:Clns1a UTSW 7 97720949 unclassified probably benign
R4810:Clns1a UTSW 7 97714017 missense probably benign 0.10
R5574:Clns1a UTSW 7 97720958 unclassified probably benign
R6608:Clns1a UTSW 7 97716468 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTTGTTCTTCCGGGCTACG -3'
(R):5'- TGCAGACTCAAAACTCAACGTG -3'

Sequencing Primer
(F):5'- TACGACTACTGCTTCCGGG -3'
(R):5'- CCAGGCTTGCAGGAGACAG -3'
Posted On2015-03-25