Incidental Mutation 'R3797:Polk'
ID272810
Institutional Source Beutler Lab
Gene Symbol Polk
Ensembl Gene ENSMUSG00000021668
Gene Namepolymerase (DNA directed), kappa
SynonymsDinb1
MMRRC Submission 040758-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock #R3797 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location96480690-96542579 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 96486982 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022172] [ENSMUST00000091387] [ENSMUST00000165358] [ENSMUST00000220977] [ENSMUST00000221645] [ENSMUST00000221899] [ENSMUST00000222075] [ENSMUST00000222143] [ENSMUST00000222389]
Predicted Effect probably benign
Transcript: ENSMUST00000022172
SMART Domains Protein: ENSMUSP00000022172
Gene: ENSMUSG00000021668

DomainStartEndE-ValueType
Pfam:IMS 105 324 1.7e-47 PFAM
Pfam:IMS_C 406 525 5.5e-22 PFAM
PDB:2LSJ|B 559 582 9e-8 PDB
ZnF_Rad18 619 645 2.89e-9 SMART
ZnF_Rad18 761 787 2.31e-8 SMART
low complexity region 828 839 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091387
SMART Domains Protein: ENSMUSP00000088950
Gene: ENSMUSG00000021668

DomainStartEndE-ValueType
Pfam:IMS 105 265 1.1e-37 PFAM
Pfam:IMS_C 346 469 8.8e-19 PFAM
PDB:2LSJ|B 500 523 9e-8 PDB
ZnF_Rad18 560 586 2.89e-9 SMART
ZnF_Rad18 702 728 2.31e-8 SMART
low complexity region 769 780 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165358
Predicted Effect probably benign
Transcript: ENSMUST00000220977
Predicted Effect probably benign
Transcript: ENSMUST00000221645
Predicted Effect probably benign
Transcript: ENSMUST00000221899
Predicted Effect probably benign
Transcript: ENSMUST00000222075
Predicted Effect probably benign
Transcript: ENSMUST00000222143
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222268
Predicted Effect probably benign
Transcript: ENSMUST00000222389
Meta Mutation Damage Score 0.0596 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNA polymerase type-Y family of proteins. The encoded protein is a specialized DNA polymerase that catalyzes translesion DNA synthesis, which allows DNA replication in the presence of DNA lesions. Human cell lines lacking a functional copy of this gene exhibit impaired genome integrity and enhanced susceptibility to oxidative damage. Mutations in this gene that impair enzyme activity may be associated with prostate cancer in human patients. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous mutation of this gene that results in a truncated transcript results in a higher rate of spontaneous germline expanded simple tandem repeat mutations. Homozyogus null mice exhibit normal immunoglobulin gene somatic hypermutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 T C 5: 30,196,823 I736V possibly damaging Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
B4galt1 G A 4: 40,807,258 T376I probably benign Het
Basp1 C A 15: 25,364,312 probably benign Het
Capn5 C T 7: 98,125,829 G535R probably null Het
Ccdc170 G A 10: 4,560,920 V660I possibly damaging Het
Cdc73 A T 1: 143,677,723 D215E probably benign Het
Clec14a G A 12: 58,267,909 A309V probably benign Het
Clns1a G A 7: 97,696,835 G36R probably benign Het
Cops7a C T 6: 124,959,832 R252H probably damaging Het
Csmd2 C T 4: 128,517,595 P2469S probably benign Het
Dsp T A 13: 38,177,284 probably null Het
Eif3d A G 15: 77,968,569 F4S probably damaging Het
Ephb1 T C 9: 101,971,267 T611A probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fgfr1 G A 8: 25,572,437 D663N probably damaging Het
Gm5592 G A 7: 41,157,835 probably benign Het
Itgb8 T C 12: 119,163,469 I683M possibly damaging Het
Kcnip3 A G 2: 127,482,014 S32P probably benign Het
Limch1 A G 5: 66,969,079 T8A probably damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Ltbp1 A G 17: 75,362,630 Q1455R probably damaging Het
Marc2 T C 1: 184,841,308 E131G possibly damaging Het
Olfr620 C T 7: 103,611,447 R302Q probably benign Het
Pak7 T C 2: 136,100,826 I465V probably benign Het
Pcdhgb8 T C 18: 37,762,675 I266T probably benign Het
Pde4d T C 13: 109,632,897 S40P probably benign Het
Phrf1 C T 7: 141,259,918 R243* probably null Het
Ppl T C 16: 5,104,550 probably benign Het
Rab11fip3 A G 17: 26,068,526 C218R possibly damaging Het
Setd2 T C 9: 110,549,571 V818A probably benign Het
Skida1 C A 2: 18,045,897 E815* probably null Het
Slc35g3 A G 11: 69,760,917 F103L probably benign Het
Svil T A 18: 5,060,534 C802S probably benign Het
Trim7 A G 11: 48,845,670 probably null Het
Ugt3a1 G A 15: 9,310,641 W336* probably null Het
Vmn2r72 T C 7: 85,738,077 S760G probably benign Het
Vps13a T C 19: 16,745,947 probably null Het
Wdfy4 A T 14: 33,140,645 I590N probably damaging Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Xpnpep1 A T 19: 53,006,342 V285D probably benign Het
Zfp934 T C 13: 62,517,888 K313R probably benign Het
Other mutations in Polk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Polk APN 13 96496760 missense probably benign 0.25
IGL01803:Polk APN 13 96504522 missense probably damaging 1.00
IGL01949:Polk APN 13 96483538 missense probably benign 0.10
IGL01986:Polk APN 13 96483823 missense probably benign 0.09
IGL02073:Polk APN 13 96504551 missense probably damaging 1.00
IGL03165:Polk APN 13 96516688 missense probably benign 0.23
IGL03184:Polk APN 13 96483983 missense probably benign 0.04
IGL03353:Polk APN 13 96489211 missense probably damaging 1.00
R0019:Polk UTSW 13 96504616 missense probably damaging 1.00
R0029:Polk UTSW 13 96516670 missense probably damaging 1.00
R0200:Polk UTSW 13 96496822 missense probably benign 0.11
R0357:Polk UTSW 13 96504597 missense probably damaging 0.99
R0485:Polk UTSW 13 96483764 missense probably benign 0.05
R0555:Polk UTSW 13 96484179 missense probably damaging 0.97
R0687:Polk UTSW 13 96484017 missense probably damaging 1.00
R0980:Polk UTSW 13 96483764 missense probably benign 0.05
R1065:Polk UTSW 13 96508252 missense probably damaging 1.00
R1396:Polk UTSW 13 96484208 missense probably benign 0.02
R1710:Polk UTSW 13 96489204 missense probably damaging 1.00
R1770:Polk UTSW 13 96495442 missense probably damaging 1.00
R1789:Polk UTSW 13 96496632 missense probably damaging 1.00
R1977:Polk UTSW 13 96489228 missense probably damaging 1.00
R2301:Polk UTSW 13 96484144 missense probably benign 0.09
R3934:Polk UTSW 13 96501635 missense possibly damaging 0.56
R4082:Polk UTSW 13 96483673 missense probably benign 0.17
R4307:Polk UTSW 13 96496666 missense possibly damaging 0.79
R4472:Polk UTSW 13 96493905 missense probably damaging 1.00
R4779:Polk UTSW 13 96496491 critical splice donor site probably null
R4795:Polk UTSW 13 96489256 missense probably benign 0.01
R4796:Polk UTSW 13 96489256 missense probably benign 0.01
R4810:Polk UTSW 13 96483495 missense possibly damaging 0.90
R5002:Polk UTSW 13 96489244 missense probably damaging 1.00
R5271:Polk UTSW 13 96483539 missense probably benign 0.09
R5415:Polk UTSW 13 96483955 missense probably benign
R5459:Polk UTSW 13 96495476 missense probably damaging 1.00
R5535:Polk UTSW 13 96495497 missense probably damaging 1.00
R5619:Polk UTSW 13 96483556 missense probably damaging 1.00
R5757:Polk UTSW 13 96484252 missense probably benign 0.03
R5801:Polk UTSW 13 96483586 missense probably damaging 1.00
R5923:Polk UTSW 13 96495415 missense probably damaging 1.00
R6365:Polk UTSW 13 96484009 missense probably damaging 1.00
R6670:Polk UTSW 13 96496630 nonsense probably null
R6831:Polk UTSW 13 96495491 missense possibly damaging 0.87
R6932:Polk UTSW 13 96516681 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCATCAGTCTTAACCGCAG -3'
(R):5'- TCATGCAGGAAGTGTGAGCTC -3'

Sequencing Primer
(F):5'- CAGGGGGTGTGGAGAACCC -3'
(R):5'- TGACTTTCAAAAGAGAATTACCCCAG -3'
Posted On2015-03-25