Incidental Mutation 'R3797:Eif3d'
ID272814
Institutional Source Beutler Lab
Gene Symbol Eif3d
Ensembl Gene ENSMUSG00000016554
Gene Nameeukaryotic translation initiation factor 3, subunit D
SynonymsEif3s7, eIF3p66, 66/67kDa, mouse translation initiation factor eIF3 p66
MMRRC Submission 040758-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.977) question?
Stock #R3797 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location77958998-77970813 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77968569 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 4 (F4S)
Ref Sequence ENSEMBL: ENSMUSP00000155152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100484] [ENSMUST00000230419]
Predicted Effect probably damaging
Transcript: ENSMUST00000100484
AA Change: F4S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098053
Gene: ENSMUSG00000016554
AA Change: F4S

DomainStartEndE-ValueType
Pfam:eIF-3_zeta 4 521 6.3e-220 PFAM
low complexity region 530 547 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229413
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229713
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229737
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229784
Predicted Effect probably damaging
Transcript: ENSMUST00000230419
AA Change: F4S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230711
Meta Mutation Damage Score 0.45 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Eukaryotic translation initiation factor-3 (eIF3), the largest of the eIFs, is a multiprotein complex composed of at least ten nonidentical subunits. The complex binds to the 40S ribosome and helps maintain the 40S and 60S ribosomal subunits in a dissociated state. It is also thought to play a role in the formation of the 40S initiation complex by interacting with the ternary complex of eIF2/GTP/methionyl-tRNA, and by promoting mRNA binding. The protein encoded by this gene is the major RNA binding subunit of the eIF3 complex. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 T C 5: 30,196,823 I736V possibly damaging Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
B4galt1 G A 4: 40,807,258 T376I probably benign Het
Basp1 C A 15: 25,364,312 probably benign Het
Capn5 C T 7: 98,125,829 G535R probably null Het
Ccdc170 G A 10: 4,560,920 V660I possibly damaging Het
Cdc73 A T 1: 143,677,723 D215E probably benign Het
Clec14a G A 12: 58,267,909 A309V probably benign Het
Clns1a G A 7: 97,696,835 G36R probably benign Het
Cops7a C T 6: 124,959,832 R252H probably damaging Het
Csmd2 C T 4: 128,517,595 P2469S probably benign Het
Dsp T A 13: 38,177,284 probably null Het
Ephb1 T C 9: 101,971,267 T611A probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fgfr1 G A 8: 25,572,437 D663N probably damaging Het
Gm5592 G A 7: 41,157,835 probably benign Het
Itgb8 T C 12: 119,163,469 I683M possibly damaging Het
Kcnip3 A G 2: 127,482,014 S32P probably benign Het
Limch1 A G 5: 66,969,079 T8A probably damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Ltbp1 A G 17: 75,362,630 Q1455R probably damaging Het
Marc2 T C 1: 184,841,308 E131G possibly damaging Het
Olfr620 C T 7: 103,611,447 R302Q probably benign Het
Pak7 T C 2: 136,100,826 I465V probably benign Het
Pcdhgb8 T C 18: 37,762,675 I266T probably benign Het
Pde4d T C 13: 109,632,897 S40P probably benign Het
Phrf1 C T 7: 141,259,918 R243* probably null Het
Polk A T 13: 96,486,982 probably benign Het
Ppl T C 16: 5,104,550 probably benign Het
Rab11fip3 A G 17: 26,068,526 C218R possibly damaging Het
Setd2 T C 9: 110,549,571 V818A probably benign Het
Skida1 C A 2: 18,045,897 E815* probably null Het
Slc35g3 A G 11: 69,760,917 F103L probably benign Het
Svil T A 18: 5,060,534 C802S probably benign Het
Trim7 A G 11: 48,845,670 probably null Het
Ugt3a1 G A 15: 9,310,641 W336* probably null Het
Vmn2r72 T C 7: 85,738,077 S760G probably benign Het
Vps13a T C 19: 16,745,947 probably null Het
Wdfy4 A T 14: 33,140,645 I590N probably damaging Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Xpnpep1 A T 19: 53,006,342 V285D probably benign Het
Zfp934 T C 13: 62,517,888 K313R probably benign Het
Other mutations in Eif3d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:Eif3d APN 15 77961869 missense probably benign
IGL01082:Eif3d APN 15 77959743 missense probably damaging 0.99
IGL01113:Eif3d APN 15 77963315 missense probably damaging 1.00
IGL01865:Eif3d APN 15 77967346 missense probably benign 0.34
IGL03070:Eif3d APN 15 77959643 missense probably damaging 1.00
IGL03277:Eif3d APN 15 77959649 missense possibly damaging 0.50
R0049:Eif3d UTSW 15 77959724 missense probably benign 0.01
R0049:Eif3d UTSW 15 77959724 missense probably benign 0.01
R0325:Eif3d UTSW 15 77968220 missense probably damaging 1.00
R1346:Eif3d UTSW 15 77968554 missense probably damaging 1.00
R2219:Eif3d UTSW 15 77964942 missense probably benign 0.35
R2993:Eif3d UTSW 15 77961705 missense possibly damaging 0.85
R3796:Eif3d UTSW 15 77968569 missense probably damaging 1.00
R3839:Eif3d UTSW 15 77964100 missense probably benign 0.30
R4690:Eif3d UTSW 15 77967316 missense probably benign 0.06
R4828:Eif3d UTSW 15 77960029 nonsense probably null
R5411:Eif3d UTSW 15 77959687 missense probably damaging 1.00
R5558:Eif3d UTSW 15 77961847 missense probably damaging 1.00
R6764:Eif3d UTSW 15 77961686 missense probably damaging 1.00
R6821:Eif3d UTSW 15 77961655 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GCCCCAAAGGAAGGATATCC -3'
(R):5'- AAAATGTCGCTGGTGTTGGC -3'

Sequencing Primer
(F):5'- TATCCATCAAGAGACTAGAAAGGC -3'
(R):5'- CAGGGTTCTGCGTTTTGAGTGTTC -3'
Posted On2015-03-25