Incidental Mutation 'R3798:Pcnx3'
ID272861
Institutional Source Beutler Lab
Gene Symbol Pcnx3
Ensembl Gene ENSMUSG00000054874
Gene Namepecanex homolog 3
SynonymsPcnxl3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R3798 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location5664635-5688908 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 5678668 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 422 (Q422*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068169] [ENSMUST00000113615] [ENSMUST00000141577]
Predicted Effect probably null
Transcript: ENSMUST00000068169
AA Change: Q594*
SMART Domains Protein: ENSMUSP00000063786
Gene: ENSMUSG00000054874
AA Change: Q594*

DomainStartEndE-ValueType
transmembrane domain 36 53 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
low complexity region 370 376 N/A INTRINSIC
transmembrane domain 385 407 N/A INTRINSIC
transmembrane domain 411 428 N/A INTRINSIC
transmembrane domain 441 463 N/A INTRINSIC
transmembrane domain 473 492 N/A INTRINSIC
transmembrane domain 501 523 N/A INTRINSIC
transmembrane domain 538 560 N/A INTRINSIC
transmembrane domain 573 592 N/A INTRINSIC
transmembrane domain 645 667 N/A INTRINSIC
transmembrane domain 669 691 N/A INTRINSIC
low complexity region 1011 1025 N/A INTRINSIC
Pfam:Pecanex_C 1159 1389 7.5e-124 PFAM
low complexity region 1462 1479 N/A INTRINSIC
low complexity region 1481 1510 N/A INTRINSIC
low complexity region 1525 1538 N/A INTRINSIC
low complexity region 1558 1569 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113615
AA Change: Q1002*
SMART Domains Protein: ENSMUSP00000109245
Gene: ENSMUSG00000054874
AA Change: Q1002*

DomainStartEndE-ValueType
transmembrane domain 36 53 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
low complexity region 438 459 N/A INTRINSIC
low complexity region 778 784 N/A INTRINSIC
transmembrane domain 793 815 N/A INTRINSIC
transmembrane domain 819 836 N/A INTRINSIC
transmembrane domain 849 871 N/A INTRINSIC
transmembrane domain 881 900 N/A INTRINSIC
transmembrane domain 909 931 N/A INTRINSIC
transmembrane domain 946 968 N/A INTRINSIC
transmembrane domain 981 1000 N/A INTRINSIC
transmembrane domain 1053 1075 N/A INTRINSIC
transmembrane domain 1077 1099 N/A INTRINSIC
low complexity region 1419 1433 N/A INTRINSIC
Pfam:Pecanex_C 1570 1796 5.9e-116 PFAM
low complexity region 1870 1887 N/A INTRINSIC
low complexity region 1889 1918 N/A INTRINSIC
low complexity region 1933 1946 N/A INTRINSIC
low complexity region 1966 1977 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127876
SMART Domains Protein: ENSMUSP00000123696
Gene: ENSMUSG00000054874

DomainStartEndE-ValueType
low complexity region 69 75 N/A INTRINSIC
transmembrane domain 84 106 N/A INTRINSIC
transmembrane domain 110 127 N/A INTRINSIC
transmembrane domain 140 162 N/A INTRINSIC
transmembrane domain 172 191 N/A INTRINSIC
transmembrane domain 200 222 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000137313
AA Change: Q99*
SMART Domains Protein: ENSMUSP00000115217
Gene: ENSMUSG00000054874
AA Change: Q99*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
transmembrane domain 79 98 N/A INTRINSIC
transmembrane domain 151 173 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141577
SMART Domains Protein: ENSMUSP00000116451
Gene: ENSMUSG00000054874

DomainStartEndE-ValueType
low complexity region 104 110 N/A INTRINSIC
transmembrane domain 119 141 N/A INTRINSIC
transmembrane domain 145 162 N/A INTRINSIC
transmembrane domain 175 197 N/A INTRINSIC
transmembrane domain 207 224 N/A INTRINSIC
transmembrane domain 229 251 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000145270
AA Change: Q422*
SMART Domains Protein: ENSMUSP00000116493
Gene: ENSMUSG00000054874
AA Change: Q422*

DomainStartEndE-ValueType
low complexity region 199 205 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 240 257 N/A INTRINSIC
transmembrane domain 270 292 N/A INTRINSIC
transmembrane domain 302 321 N/A INTRINSIC
transmembrane domain 330 352 N/A INTRINSIC
transmembrane domain 367 389 N/A INTRINSIC
transmembrane domain 402 421 N/A INTRINSIC
transmembrane domain 474 496 N/A INTRINSIC
transmembrane domain 498 520 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184789
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadsb T A 7: 131,431,965 V237E probably damaging Het
Adgrf3 T C 5: 30,196,823 I736V possibly damaging Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
Basp1 C A 15: 25,364,312 probably benign Het
Bbs9 T C 9: 22,638,769 S21P probably damaging Het
Btbd16 A G 7: 130,777,140 N5D probably benign Het
Csmd2 C T 4: 128,517,595 P2469S probably benign Het
Cyld T C 8: 88,734,930 L662P probably damaging Het
Eif2ak4 C T 2: 118,474,083 R1530C probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Ip6k3 T C 17: 27,145,106 I323V probably benign Het
Itpr1 T C 6: 108,381,270 L599P probably damaging Het
Lancl1 G A 1: 67,034,144 T60I probably damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Lrrc8d T A 5: 105,812,489 I255N probably benign Het
Ndst1 A G 18: 60,713,166 F24L possibly damaging Het
Notch1 A T 2: 26,478,618 V553E probably benign Het
Nsd3 T A 8: 25,698,845 W69R probably damaging Het
Olfr117 T A 17: 37,660,106 I76F probably damaging Het
Pcm1 T C 8: 41,258,014 I107T possibly damaging Het
Phrf1 C T 7: 141,259,918 R243* probably null Het
Ptbp3 T C 4: 59,546,166 I9V probably benign Het
Sacs T C 14: 61,206,121 V1872A possibly damaging Het
Slc35g3 A G 11: 69,760,917 F103L probably benign Het
Slx4ip T A 2: 137,067,623 D109E probably benign Het
Tas2r118 T C 6: 23,969,823 K80E possibly damaging Het
Ttn T C 2: 76,894,743 probably benign Het
Vmn2r72 T C 7: 85,738,077 S760G probably benign Het
Vmn2r79 A G 7: 87,002,194 Y267C possibly damaging Het
Wdr90 T C 17: 25,850,498 S1194G probably benign Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Other mutations in Pcnx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01616:Pcnx3 APN 19 5667259 unclassified probably benign
IGL01667:Pcnx3 APN 19 5686630 missense probably benign 0.03
IGL01704:Pcnx3 APN 19 5667476 missense probably damaging 1.00
IGL01752:Pcnx3 APN 19 5665337 nonsense probably null
IGL01791:Pcnx3 APN 19 5673267 missense probably benign 0.39
IGL01937:Pcnx3 APN 19 5677663 missense probably benign
IGL01987:Pcnx3 APN 19 5677479 missense probably damaging 1.00
IGL02073:Pcnx3 APN 19 5679386 missense probably damaging 0.99
IGL02417:Pcnx3 APN 19 5686481 missense possibly damaging 0.92
IGL03143:Pcnx3 APN 19 5685395 missense probably damaging 1.00
PIT4453001:Pcnx3 UTSW 19 5672756 critical splice donor site probably null
R0234:Pcnx3 UTSW 19 5672618 missense probably benign 0.12
R0234:Pcnx3 UTSW 19 5672618 missense probably benign 0.12
R0360:Pcnx3 UTSW 19 5665583 missense probably damaging 0.98
R0687:Pcnx3 UTSW 19 5684333 missense probably damaging 1.00
R0718:Pcnx3 UTSW 19 5677728 splice site probably benign
R0840:Pcnx3 UTSW 19 5685701 unclassified probably null
R0907:Pcnx3 UTSW 19 5671525 missense possibly damaging 0.95
R1251:Pcnx3 UTSW 19 5677182 missense probably benign 0.03
R1373:Pcnx3 UTSW 19 5665516 missense probably damaging 0.97
R1467:Pcnx3 UTSW 19 5674894 missense possibly damaging 0.63
R1467:Pcnx3 UTSW 19 5674894 missense possibly damaging 0.63
R1572:Pcnx3 UTSW 19 5685347 nonsense probably null
R1602:Pcnx3 UTSW 19 5672515 missense probably damaging 1.00
R1628:Pcnx3 UTSW 19 5686065 missense probably damaging 0.99
R1635:Pcnx3 UTSW 19 5665745 missense probably benign 0.00
R1670:Pcnx3 UTSW 19 5673315 missense probably damaging 1.00
R1889:Pcnx3 UTSW 19 5672656 missense probably damaging 1.00
R1898:Pcnx3 UTSW 19 5672587 missense probably damaging 1.00
R2113:Pcnx3 UTSW 19 5671556 missense possibly damaging 0.93
R2147:Pcnx3 UTSW 19 5667605 missense probably damaging 1.00
R2358:Pcnx3 UTSW 19 5683339 nonsense probably null
R2358:Pcnx3 UTSW 19 5683340 start codon destroyed probably null
R2871:Pcnx3 UTSW 19 5683746 intron probably benign
R3699:Pcnx3 UTSW 19 5672465 missense probably damaging 1.00
R3712:Pcnx3 UTSW 19 5683339 nonsense probably null
R3712:Pcnx3 UTSW 19 5683340 start codon destroyed probably null
R3856:Pcnx3 UTSW 19 5678967 missense probably benign 0.02
R3953:Pcnx3 UTSW 19 5683780 splice site probably benign
R4613:Pcnx3 UTSW 19 5667219 missense possibly damaging 0.51
R4781:Pcnx3 UTSW 19 5687130 missense probably damaging 0.99
R4816:Pcnx3 UTSW 19 5687995 critical splice donor site probably null
R5338:Pcnx3 UTSW 19 5672596 missense probably damaging 1.00
R5770:Pcnx3 UTSW 19 5681579 intron probably benign
R5950:Pcnx3 UTSW 19 5667158 missense possibly damaging 0.81
R5951:Pcnx3 UTSW 19 5671680 missense possibly damaging 0.71
R5969:Pcnx3 UTSW 19 5685535 missense probably damaging 1.00
R6543:Pcnx3 UTSW 19 5665247 missense probably benign 0.07
R6704:Pcnx3 UTSW 19 5686487 missense possibly damaging 0.74
R7096:Pcnx3 UTSW 19 5672615 missense probably damaging 1.00
X0028:Pcnx3 UTSW 19 5684427 missense probably damaging 1.00
X0053:Pcnx3 UTSW 19 5686622 splice site probably null
Predicted Primers PCR Primer
(F):5'- CTCAGAGGGTACTGTCATGTAC -3'
(R):5'- GCAGTGGCTTCTCACATACG -3'

Sequencing Primer
(F):5'- CACACTCAGAGAGTATTCTGTCATG -3'
(R):5'- AGTGGCTTCTCACATACGACATC -3'
Posted On2015-03-25