Incidental Mutation 'R3801:Triobp'
ID273009
Institutional Source Beutler Lab
Gene Symbol Triobp
Ensembl Gene ENSMUSG00000033088
Gene NameTRIO and F-actin binding protein
SynonymsEST478828, Mus EST 478828, Tara
MMRRC Submission 040760-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3801 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location78947724-79005869 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 78973700 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 1167 (Q1167L)
Ref Sequence ENSEMBL: ENSMUSP00000105312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109689] [ENSMUST00000109690] [ENSMUST00000140228] [ENSMUST00000229270]
Predicted Effect probably benign
Transcript: ENSMUST00000109689
AA Change: Q1167L

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000105311
Gene: ENSMUSG00000033088
AA Change: Q1167L

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 7.43e-13 PROSPERO
internal_repeat_1 390 540 7.43e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1395 1492 6.2e-19 SMART
coiled coil region 1665 1692 N/A INTRINSIC
coiled coil region 1727 1765 N/A INTRINSIC
coiled coil region 1789 1851 N/A INTRINSIC
coiled coil region 1885 1964 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109690
AA Change: Q1167L

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000105312
Gene: ENSMUSG00000033088
AA Change: Q1167L

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 9.24e-13 PROSPERO
internal_repeat_1 390 540 9.24e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1441 1538 6.2e-19 SMART
coiled coil region 1711 1738 N/A INTRINSIC
coiled coil region 1773 1811 N/A INTRINSIC
coiled coil region 1835 1897 N/A INTRINSIC
coiled coil region 1931 2010 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140228
Predicted Effect probably benign
Transcript: ENSMUST00000229270
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that interacts with trio, which is involved with neural tissue development and controlling actin cytoskeleton organization, cell motility, and cell growth. The encoded protein also associates with F-actin and stabilizes F-actin structures. Domains contained in this encoded protein are an N-terminal pleckstrin homology domain and a C-terminal coiled-coil region. Mutations in the human gene have been associated with a form of autosomal recessive nonsyndromic deafness. Multiple alternatively spliced transcript variants have been described [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for gene trapped alleles exhibit embryonic lethality. Mice homozygous for a targeted allele eliminating isoforms 4 and 5 exhibit profound deafness associated with stereocilia fragility and degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik C T 8: 79,248,293 E54K probably benign Het
Als2 A C 1: 59,167,199 M1634R probably damaging Het
Ankfy1 T C 11: 72,749,420 S531P probably benign Het
Atp6v1e1 A G 6: 120,801,059 Y172H probably benign Het
Brd1 C T 15: 88,717,040 V464M probably damaging Het
Btaf1 A T 19: 36,986,548 T840S probably benign Het
Btaf1 A T 19: 36,988,973 H1047L probably benign Het
Cacnb2 A G 2: 14,824,263 D3G possibly damaging Het
Capn13 G A 17: 73,339,401 P339L probably benign Het
Cgrrf1 G T 14: 46,832,363 G30C probably damaging Het
Crnkl1 T C 2: 145,919,795 D614G probably benign Het
Cyp2c23 C T 19: 44,007,039 V430I probably benign Het
Dazl G A 17: 50,281,281 R289W probably benign Het
Dsg1b C T 18: 20,390,203 P96S probably damaging Het
Dusp14 A G 11: 84,048,709 S169P possibly damaging Het
Egfem1 A G 3: 29,151,926 D91G probably benign Het
Eif1 A G 11: 100,320,824 K95E probably damaging Het
Fap C T 2: 62,546,650 V191I probably benign Het
Flnc T C 6: 29,447,404 Y1069H probably damaging Het
Fndc7 T C 3: 108,869,148 T526A possibly damaging Het
Fras1 A T 5: 96,733,932 T2508S probably benign Het
Gast T C 11: 100,336,810 S73P probably damaging Het
Grap2 A G 15: 80,623,746 T4A possibly damaging Het
Grm8 T G 6: 28,125,636 N164H possibly damaging Het
Hyal5 A T 6: 24,876,524 H132L probably benign Het
Iqcm C A 8: 75,669,393 T188K possibly damaging Het
Kank4 A G 4: 98,780,133 S26P probably damaging Het
Lipo1 C T 19: 33,784,857 C80Y probably damaging Het
Lrrk2 A G 15: 91,737,111 R963G probably benign Het
Lrtm2 G A 6: 119,317,483 T229I probably damaging Het
Mb21d2 A T 16: 28,828,003 D406E possibly damaging Het
Meikin T A 11: 54,399,871 probably null Het
Mybl1 A T 1: 9,673,214 F538I probably damaging Het
Nectin2 T C 7: 19,717,636 D491G probably benign Het
Nf1 A G 11: 79,559,521 D511G probably null Het
Nid2 T C 14: 19,809,997 C1328R probably damaging Het
Nlrp1a T A 11: 71,122,703 M574L probably benign Het
Nrap C T 19: 56,321,779 D1595N probably damaging Het
Nrg3 G A 14: 38,376,434 P496S probably damaging Het
Olfr1287 A T 2: 111,449,565 I142F probably benign Het
Pak3 G A X: 143,709,731 V87I probably damaging Het
Phf8 T C X: 151,572,576 S512P possibly damaging Het
Phkb G T 8: 85,922,229 E225* probably null Het
Plaa T C 4: 94,569,888 D615G probably damaging Het
Prdm12 A G 2: 31,651,947 K223E probably damaging Het
Prkd1 C A 12: 50,383,422 R634L possibly damaging Het
Rassf3 T A 10: 121,414,366 I181F possibly damaging Het
Samd8 G A 14: 21,775,065 V30M probably damaging Het
Sema4f A T 6: 82,918,627 H308Q possibly damaging Het
Skint4 G T 4: 112,118,181 V113L probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slpi A G 2: 164,356,238 L12P probably damaging Het
Smco1 A G 16: 32,273,898 Y129C probably benign Het
Spag17 A G 3: 100,053,853 K985R possibly damaging Het
Stc1 T C 14: 69,038,475 I239T probably benign Het
Suclg2 A T 6: 95,497,668 I372N probably damaging Het
Tmed4 C A 11: 6,274,233 V80F probably damaging Het
Tnpo2 T A 8: 85,055,171 probably null Het
Top1 A G 2: 160,702,768 H268R probably damaging Het
Txndc16 G A 14: 45,151,352 P536L possibly damaging Het
Usp13 C T 3: 32,881,508 A360V possibly damaging Het
Vhl G A 6: 113,629,462 V147I probably benign Het
Vldlr A T 19: 27,217,621 T3S probably damaging Het
Vps54 T A 11: 21,268,832 D130E probably benign Het
Zfp808 T A 13: 62,172,083 H375Q probably damaging Het
Zfp87 A T 13: 67,521,215 N37K probably damaging Het
Other mutations in Triobp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Triobp APN 15 78993368 missense probably damaging 1.00
IGL01904:Triobp APN 15 78967364 missense possibly damaging 0.80
IGL01957:Triobp APN 15 78972647 critical splice donor site probably null
IGL02085:Triobp APN 15 78974297 splice site probably benign
IGL02260:Triobp APN 15 78966362 missense probably benign 0.00
IGL02498:Triobp APN 15 78961043 missense probably benign 0.01
IGL02551:Triobp APN 15 78973489 missense probably benign
IGL02740:Triobp APN 15 78966689 missense probably benign 0.21
IGL02810:Triobp APN 15 79002203 missense possibly damaging 0.95
IGL03063:Triobp APN 15 78990884 missense probably damaging 1.00
FR4304:Triobp UTSW 15 78993387 unclassified probably benign
FR4340:Triobp UTSW 15 78993390 unclassified probably benign
FR4342:Triobp UTSW 15 78993392 unclassified probably benign
FR4449:Triobp UTSW 15 78993389 unclassified probably benign
FR4548:Triobp UTSW 15 78993387 unclassified probably benign
FR4548:Triobp UTSW 15 78993390 unclassified probably benign
R0276:Triobp UTSW 15 78973676 missense probably benign 0.09
R0309:Triobp UTSW 15 78976540 missense probably damaging 1.00
R0433:Triobp UTSW 15 78968201 missense possibly damaging 0.69
R0464:Triobp UTSW 15 78966986 missense possibly damaging 0.71
R0525:Triobp UTSW 15 78973898 missense possibly damaging 0.93
R0665:Triobp UTSW 15 78973898 missense possibly damaging 0.93
R0689:Triobp UTSW 15 78959988 nonsense probably null
R1149:Triobp UTSW 15 78966479 missense probably benign 0.00
R1149:Triobp UTSW 15 78966479 missense probably benign 0.00
R1151:Triobp UTSW 15 78966479 missense probably benign 0.00
R1152:Triobp UTSW 15 78966479 missense probably benign 0.00
R1510:Triobp UTSW 15 79003767 missense probably damaging 1.00
R1519:Triobp UTSW 15 78973738 missense probably benign 0.00
R1642:Triobp UTSW 15 79002148 missense probably damaging 1.00
R1732:Triobp UTSW 15 78967228 missense possibly damaging 0.69
R1755:Triobp UTSW 15 78966479 missense probably benign 0.00
R1975:Triobp UTSW 15 78966708 missense probably benign
R2051:Triobp UTSW 15 79004540 missense probably damaging 1.00
R2073:Triobp UTSW 15 78973895 missense probably damaging 0.99
R2260:Triobp UTSW 15 78991440 critical splice donor site probably null
R2351:Triobp UTSW 15 79004580 missense probably benign 0.09
R2902:Triobp UTSW 15 78973418 missense possibly damaging 0.90
R3959:Triobp UTSW 15 79002389 nonsense probably null
R4003:Triobp UTSW 15 78959977 unclassified probably benign
R4084:Triobp UTSW 15 78973671 missense probably benign 0.19
R4482:Triobp UTSW 15 78966563 missense possibly damaging 0.87
R4592:Triobp UTSW 15 78967095 missense probably benign
R4662:Triobp UTSW 15 78993269 missense probably damaging 1.00
R4732:Triobp UTSW 15 78967113 missense probably damaging 0.99
R4733:Triobp UTSW 15 78967113 missense probably damaging 0.99
R4789:Triobp UTSW 15 78991028 missense probably damaging 1.00
R4968:Triobp UTSW 15 78966616 missense probably benign 0.03
R4990:Triobp UTSW 15 78967005 missense probably benign 0.00
R5129:Triobp UTSW 15 78961096 missense probably benign 0.15
R5181:Triobp UTSW 15 78967754 missense probably benign 0.00
R5279:Triobp UTSW 15 78994391 missense possibly damaging 0.66
R5584:Triobp UTSW 15 78968132 missense possibly damaging 0.89
R5601:Triobp UTSW 15 78973633 missense probably damaging 1.00
R5810:Triobp UTSW 15 78968267 missense probably benign 0.07
R5969:Triobp UTSW 15 78967540 missense probably benign 0.05
R6722:Triobp UTSW 15 79001565 missense probably damaging 1.00
R6739:Triobp UTSW 15 78966366 missense possibly damaging 0.77
R6810:Triobp UTSW 15 78966615 missense possibly damaging 0.47
R7011:Triobp UTSW 15 78978723 missense probably damaging 0.98
R7015:Triobp UTSW 15 78994060 missense probably damaging 0.99
R7200:Triobp UTSW 15 78966842 small deletion probably benign
R7294:Triobp UTSW 15 78973976 missense probably damaging 0.99
X0026:Triobp UTSW 15 78960023 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GCTGTCAGGACCTCAAAGTC -3'
(R):5'- TAGCAGGTCCCTCCAATCTAGG -3'

Sequencing Primer
(F):5'- CAGACACCCAGAGAAGAGCTG -3'
(R):5'- TCCCTCCAATCTAGGTCGGGTG -3'
Posted On2015-03-25