Incidental Mutation 'R3767:Fgfrl1'
ID 273049
Institutional Source Beutler Lab
Gene Symbol Fgfrl1
Ensembl Gene ENSMUSG00000008090
Gene Name fibroblast growth factor receptor-like 1
Synonyms FGFR5gamma, fibroblast growth factor receptor 5, FGFR5, FGFR5beta
MMRRC Submission 040744-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3767 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 108842051-108854816 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 108853242 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 197 (H197Q)
Ref Sequence ENSEMBL: ENSMUSP00000108179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013633] [ENSMUST00000112560] [ENSMUST00000196222] [ENSMUST00000197255]
AlphaFold Q91V87
Predicted Effect probably benign
Transcript: ENSMUST00000013633
AA Change: H288Q

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000013633
Gene: ENSMUSG00000008090
AA Change: H288Q

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 38 102 2.64e-12 SMART
low complexity region 117 131 N/A INTRINSIC
IGc2 159 224 1.35e-18 SMART
IGc2 255 341 6.16e-4 SMART
transmembrane domain 372 394 N/A INTRINSIC
low complexity region 468 479 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112560
AA Change: H197Q

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108179
Gene: ENSMUSG00000008090
AA Change: H197Q

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 26 40 N/A INTRINSIC
IGc2 68 133 1.35e-18 SMART
IGc2 164 250 6.16e-4 SMART
transmembrane domain 281 303 N/A INTRINSIC
low complexity region 377 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196222
SMART Domains Protein: ENSMUSP00000143037
Gene: ENSMUSG00000008090

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 38 102 1.1e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199802
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor receptor (FGFR) family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. A marked difference between this gene product and the other family members is its lack of a cytoplasmic tyrosine kinase domain. The result is a transmembrane receptor that could interact with other family members and potentially inhibit signaling. Multiple alternatively spliced transcript variants encoding the same isoform have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show neonatal death due to respiratory distress, a malformed diaphragm, and lack of metanephric kidneys. Homozygotes for a different null allele show both fetal and neonatal death, a similar diaphragm defect, as well as cardiac and skeletal defects, and fetal anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adipoq T A 16: 22,975,938 (GRCm39) V134E possibly damaging Het
Agmat A G 4: 141,483,273 (GRCm39) T236A probably benign Het
Anxa9 T C 3: 95,208,425 (GRCm39) N197S probably benign Het
Arhgap23 A T 11: 97,366,932 (GRCm39) D1071V probably damaging Het
Axdnd1 G A 1: 156,208,428 (GRCm39) T470M probably damaging Het
C3 C T 17: 57,512,303 (GRCm39) D1542N possibly damaging Het
Cdh3 A T 8: 107,263,606 (GRCm39) probably null Het
Cep85l A T 10: 53,167,906 (GRCm39) I624K probably benign Het
Cplx4 T C 18: 66,102,998 (GRCm39) T41A probably benign Het
Dchs1 A T 7: 105,406,292 (GRCm39) D2313E possibly damaging Het
Dock7 T C 4: 98,859,066 (GRCm39) T1409A probably benign Het
Exo1 C T 1: 175,714,312 (GRCm39) P73L probably damaging Het
Fsbp G A 4: 11,583,706 (GRCm39) G135D probably damaging Het
Herc3 G A 6: 58,839,973 (GRCm39) R362H probably benign Het
Herc3 T C 6: 58,853,587 (GRCm39) F583L probably benign Het
Ifna7 T C 4: 88,734,964 (GRCm39) V167A probably damaging Het
Ighv1-54 A G 12: 115,157,596 (GRCm39) V17A possibly damaging Het
Kcnh5 A G 12: 75,134,350 (GRCm39) Y400H possibly damaging Het
Kcnk16 T A 14: 20,319,230 (GRCm39) M1L possibly damaging Het
Kctd19 T C 8: 106,123,112 (GRCm39) T101A probably benign Het
Klf3 A G 5: 64,984,560 (GRCm39) probably null Het
Krtap12-1 G T 10: 77,556,729 (GRCm39) V91L probably benign Het
Lonp1 T C 17: 56,928,952 (GRCm39) E270G possibly damaging Het
Mgl2 T C 11: 70,026,659 (GRCm39) L128P probably damaging Het
Mrc1 A G 2: 14,323,981 (GRCm39) Y1106C probably damaging Het
Mybpc1 G T 10: 88,406,521 (GRCm39) probably null Het
Mypn C A 10: 62,961,486 (GRCm39) L1035F possibly damaging Het
Neurl1a T C 19: 47,228,328 (GRCm39) L58P probably damaging Het
Nlrp4e G T 7: 23,039,988 (GRCm39) L770F probably damaging Het
Npas3 A G 12: 54,115,857 (GRCm39) *895W probably null Het
Nphs2 T C 1: 156,140,608 (GRCm39) I115T probably damaging Het
Or1ad6 A G 11: 50,860,385 (GRCm39) D180G probably damaging Het
Or8g22 T A 9: 38,958,707 (GRCm39) H47L unknown Het
Patj A T 4: 98,569,456 (GRCm39) K1128* probably null Het
Pla2g5 C G 4: 138,528,746 (GRCm39) C70S probably damaging Het
Pole4 G A 6: 82,599,095 (GRCm39) R119C possibly damaging Het
Ppm1h G T 10: 122,740,027 (GRCm39) L367F probably damaging Het
Ppp1r13b G T 12: 111,812,851 (GRCm39) R123S probably damaging Het
Ptpru C T 4: 131,535,735 (GRCm39) C414Y probably damaging Het
Pum2 T A 12: 8,769,076 (GRCm39) Y323* probably null Het
Rhot2 T C 17: 26,059,521 (GRCm39) D407G probably benign Het
Rreb1 C T 13: 38,113,579 (GRCm39) R313W possibly damaging Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Scn11a T A 9: 119,613,115 (GRCm39) D825V probably damaging Het
Selenoi A G 5: 30,461,187 (GRCm39) Y141C probably damaging Het
Smcr8 A G 11: 60,670,330 (GRCm39) T493A probably benign Het
Tjp2 A T 19: 24,078,190 (GRCm39) I901N probably benign Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Ttc23l T A 15: 10,530,781 (GRCm39) Y277F possibly damaging Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Wdr1 C T 5: 38,697,882 (GRCm39) G228R probably damaging Het
Xab2 T C 8: 3,669,053 (GRCm39) N31S probably damaging Het
Other mutations in Fgfrl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Fgfrl1 APN 5 108,853,753 (GRCm39) missense probably damaging 1.00
IGL00756:Fgfrl1 APN 5 108,853,819 (GRCm39) missense possibly damaging 0.91
IGL02641:Fgfrl1 APN 5 108,853,731 (GRCm39) missense probably damaging 1.00
R0725:Fgfrl1 UTSW 5 108,852,539 (GRCm39) missense probably damaging 0.99
R1398:Fgfrl1 UTSW 5 108,854,147 (GRCm39) unclassified probably benign
R1967:Fgfrl1 UTSW 5 108,852,871 (GRCm39) missense probably damaging 1.00
R2403:Fgfrl1 UTSW 5 108,852,897 (GRCm39) missense probably damaging 1.00
R3032:Fgfrl1 UTSW 5 108,853,926 (GRCm39) missense probably benign 0.13
R3605:Fgfrl1 UTSW 5 108,853,289 (GRCm39) missense probably damaging 0.96
R3606:Fgfrl1 UTSW 5 108,853,289 (GRCm39) missense probably damaging 0.96
R3607:Fgfrl1 UTSW 5 108,853,289 (GRCm39) missense probably damaging 0.96
R4603:Fgfrl1 UTSW 5 108,851,401 (GRCm39) missense probably damaging 1.00
R4798:Fgfrl1 UTSW 5 108,851,363 (GRCm39) nonsense probably null
R5600:Fgfrl1 UTSW 5 108,853,168 (GRCm39) missense probably damaging 1.00
R6349:Fgfrl1 UTSW 5 108,853,372 (GRCm39) missense probably damaging 1.00
R6679:Fgfrl1 UTSW 5 108,852,839 (GRCm39) missense probably damaging 1.00
R6679:Fgfrl1 UTSW 5 108,852,838 (GRCm39) nonsense probably null
R7247:Fgfrl1 UTSW 5 108,851,365 (GRCm39) missense possibly damaging 0.91
R7608:Fgfrl1 UTSW 5 108,853,211 (GRCm39) missense probably damaging 1.00
R7947:Fgfrl1 UTSW 5 108,853,142 (GRCm39) missense probably damaging 0.96
R8933:Fgfrl1 UTSW 5 108,851,257 (GRCm39) missense probably damaging 0.96
R9039:Fgfrl1 UTSW 5 108,853,439 (GRCm39) critical splice donor site probably null
R9661:Fgfrl1 UTSW 5 108,853,841 (GRCm39) missense probably benign
X0018:Fgfrl1 UTSW 5 108,852,840 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGGTGCCTAAAACTGTGCTG -3'
(R):5'- ACACACCTGGTAATACAGTGAG -3'

Sequencing Primer
(F):5'- GTGCCTAAAACTGTGCTGACATG -3'
(R):5'- CACCTGGTAATACAGTGAGGAAGGC -3'
Posted On 2015-03-25