Incidental Mutation 'R3767:Tns2'
ID273082
Institutional Source Beutler Lab
Gene Symbol Tns2
Ensembl Gene ENSMUSG00000037003
Gene Nametensin 2
Synonymsnph, nep, Tenc1
MMRRC Submission 040744-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3767 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location102100413-102116401 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 102108934 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 281 (R281C)
Ref Sequence ENSEMBL: ENSMUSP00000155830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046144] [ENSMUST00000169627] [ENSMUST00000228958] [ENSMUST00000229592] [ENSMUST00000230474]
Predicted Effect probably damaging
Transcript: ENSMUST00000046144
AA Change: R281C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041087
Gene: ENSMUSG00000037003
AA Change: R281C

DomainStartEndE-ValueType
C1 32 79 2.78e-9 SMART
SCOP:d1d5ra2 128 295 8e-24 SMART
PTEN_C2 297 424 6.63e-40 SMART
low complexity region 494 513 N/A INTRINSIC
SH2 1136 1236 1.69e-16 SMART
PTB 1269 1407 6.66e-28 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169627
AA Change: R281C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129146
Gene: ENSMUSG00000037003
AA Change: R281C

DomainStartEndE-ValueType
C1 32 79 2.78e-9 SMART
SCOP:d1d5ra2 128 295 8e-24 SMART
PTEN_C2 297 424 6.63e-40 SMART
low complexity region 494 513 N/A INTRINSIC
SH2 1129 1229 1.69e-16 SMART
PTB 1262 1400 6.66e-28 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000228958
AA Change: R281C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229035
Predicted Effect probably benign
Transcript: ENSMUST00000229592
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229908
Predicted Effect probably damaging
Transcript: ENSMUST00000230474
AA Change: R273C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.344 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype Strain: 2447990
Lethality: D70-D210
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the tensin family. Tensin is a focal adhesion molecule that binds to actin filaments and participates in signaling pathways. This protein plays a role in regulating cell migration. Alternative splicing occurs at this locus and three transcript variants encoding three distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Affected mice homozygous for a spontaneous deletion show reduced female fertility, increased blood urea nitrogen, low hematocrit, proteinuria, hypoproteinemia, hypercholesterolemia, small kidneys with a yellowish granular surface, glomerular lesions and premature death; some develop systemic edema. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adipoq T A 16: 23,157,188 V134E possibly damaging Het
Agmat A G 4: 141,755,962 T236A probably benign Het
Anxa9 T C 3: 95,301,114 N197S probably benign Het
Arhgap23 A T 11: 97,476,106 D1071V probably damaging Het
Axdnd1 G A 1: 156,380,858 T470M probably damaging Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Cdh3 A T 8: 106,536,974 probably null Het
Cep85l A T 10: 53,291,810 I624K probably benign Het
Cplx4 T C 18: 65,969,927 T41A probably benign Het
Dchs1 A T 7: 105,757,085 D2313E possibly damaging Het
Dock7 T C 4: 98,970,829 T1409A probably benign Het
Exo1 C T 1: 175,886,746 P73L probably damaging Het
Fgfrl1 C A 5: 108,705,376 H197Q possibly damaging Het
Fsbp G A 4: 11,583,706 G135D probably damaging Het
Herc3 G A 6: 58,862,988 R362H probably benign Het
Herc3 T C 6: 58,876,602 F583L probably benign Het
Ifna7 T C 4: 88,816,727 V167A probably damaging Het
Ighv1-54 A G 12: 115,193,976 V17A possibly damaging Het
Kcnh5 A G 12: 75,087,576 Y400H possibly damaging Het
Kcnk16 T A 14: 20,269,162 M1L possibly damaging Het
Kctd19 T C 8: 105,396,480 T101A probably benign Het
Klf3 A G 5: 64,827,217 probably null Het
Krtap12-1 G T 10: 77,720,895 V91L probably benign Het
Lonp1 T C 17: 56,621,952 E270G possibly damaging Het
Mgl2 T C 11: 70,135,833 L128P probably damaging Het
Mrc1 A G 2: 14,319,170 Y1106C probably damaging Het
Mybpc1 G T 10: 88,570,659 probably null Het
Mypn C A 10: 63,125,707 L1035F possibly damaging Het
Neurl1a T C 19: 47,239,889 L58P probably damaging Het
Nlrp4e G T 7: 23,340,563 L770F probably damaging Het
Npas3 A G 12: 54,069,074 *895W probably null Het
Nphs2 T C 1: 156,313,038 I115T probably damaging Het
Olfr1378 A G 11: 50,969,558 D180G probably damaging Het
Olfr936 T A 9: 39,047,411 H47L unknown Het
Patj A T 4: 98,681,219 K1128* probably null Het
Pla2g5 C G 4: 138,801,435 C70S probably damaging Het
Pole4 G A 6: 82,622,114 R119C possibly damaging Het
Ppm1h G T 10: 122,904,122 L367F probably damaging Het
Ppp1r13b G T 12: 111,846,417 R123S probably damaging Het
Ptpru C T 4: 131,808,424 C414Y probably damaging Het
Pum2 T A 12: 8,719,076 Y323* probably null Het
Rhot2 T C 17: 25,840,547 D407G probably benign Het
Rreb1 C T 13: 37,929,603 R313W possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scn11a T A 9: 119,784,049 D825V probably damaging Het
Selenoi A G 5: 30,256,189 Y141C probably damaging Het
Smcr8 A G 11: 60,779,504 T493A probably benign Het
Tjp2 A T 19: 24,100,826 I901N probably benign Het
Ttc23l T A 15: 10,530,695 Y277F possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Wdr1 C T 5: 38,540,539 G228R probably damaging Het
Xab2 T C 8: 3,619,053 N31S probably damaging Het
Other mutations in Tns2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01575:Tns2 APN 15 102113191 missense probably damaging 1.00
IGL01935:Tns2 APN 15 102111634 unclassified probably null
IGL01994:Tns2 APN 15 102111379 missense possibly damaging 0.81
IGL02025:Tns2 APN 15 102112049 nonsense probably null
IGL02135:Tns2 APN 15 102113026 missense probably damaging 1.00
IGL02355:Tns2 APN 15 102112290 missense probably benign
IGL02362:Tns2 APN 15 102112290 missense probably benign
IGL02439:Tns2 APN 15 102114543 missense probably damaging 1.00
IGL02488:Tns2 APN 15 102112743 missense probably benign
IGL02546:Tns2 APN 15 102110940 missense probably damaging 1.00
IGL02616:Tns2 APN 15 102111415 missense probably benign
IGL02628:Tns2 APN 15 102111828 missense probably benign 0.04
IGL02658:Tns2 APN 15 102107796 splice site probably benign
IGL03267:Tns2 APN 15 102105378 critical splice donor site probably null
P0005:Tns2 UTSW 15 102114056 missense probably damaging 0.98
R0586:Tns2 UTSW 15 102109585 splice site probably benign
R0791:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R0817:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R0818:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R0819:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R0820:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1451:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1452:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1453:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1454:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1455:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1487:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1510:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1579:Tns2 UTSW 15 102111210 missense probably damaging 1.00
R1698:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1772:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1779:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1843:Tns2 UTSW 15 102113133 unclassified probably null
R1923:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1924:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1927:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1980:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2051:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2087:Tns2 UTSW 15 102107119 missense possibly damaging 0.70
R2100:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2103:Tns2 UTSW 15 102112665 critical splice acceptor site probably null
R2105:Tns2 UTSW 15 102107506 missense probably benign 0.27
R2224:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2225:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2227:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2252:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2253:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2290:Tns2 UTSW 15 102112023 missense probably damaging 0.99
R2304:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2318:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2446:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2447:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2448:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2566:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2567:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2897:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2898:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3159:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3160:Tns2 UTSW 15 102113336 missense possibly damaging 0.88
R3162:Tns2 UTSW 15 102113336 missense possibly damaging 0.88
R3162:Tns2 UTSW 15 102113336 missense possibly damaging 0.88
R3196:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3237:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3426:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3427:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3428:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3695:Tns2 UTSW 15 102112749 missense probably null
R3911:Tns2 UTSW 15 102113837 critical splice donor site probably null
R4113:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4157:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4394:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4395:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4396:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4439:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4441:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4537:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4538:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4541:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4599:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4600:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4602:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4773:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4774:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4775:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4776:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4880:Tns2 UTSW 15 102112039 missense probably damaging 0.98
R4989:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5014:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5058:Tns2 UTSW 15 102107860 missense possibly damaging 0.68
R5253:Tns2 UTSW 15 102111453 missense probably damaging 1.00
R5336:Tns2 UTSW 15 102111229 missense probably damaging 1.00
R5351:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5452:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5453:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5629:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5630:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5631:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5685:Tns2 UTSW 15 102107103 missense probably benign 0.02
R5844:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R6048:Tns2 UTSW 15 102111411 missense probably damaging 1.00
R6067:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R6079:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R6130:Tns2 UTSW 15 102111241 missense probably damaging 1.00
R6136:Tns2 UTSW 15 102107030 missense probably damaging 1.00
R6138:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R6199:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R6210:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R6426:Tns2 UTSW 15 102107037 missense possibly damaging 0.65
R6544:Tns2 UTSW 15 102113834 missense possibly damaging 0.93
R6594:Tns2 UTSW 15 102110559 missense probably benign 0.00
R6596:Tns2 UTSW 15 102110559 missense probably benign 0.00
R6734:Tns2 UTSW 15 102103116 missense probably damaging 0.96
U15987:Tns2 UTSW 15 102108934 missense probably damaging 1.00
X0009:Tns2 UTSW 15 102112465 missense possibly damaging 0.94
X0026:Tns2 UTSW 15 102110502 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAGGATCTCATGATTCCTCC -3'
(R):5'- CCTGTGGAGTCTTTCTTACAAGC -3'

Sequencing Primer
(F):5'- CCTTCCCTGGGGTTTAGGTATAGAAG -3'
(R):5'- GCCAGAACGATCTAGTCTGTTTACG -3'
Posted On2015-03-25