Incidental Mutation 'R3768:Tarm1'
ID273113
Institutional Source Beutler Lab
Gene Symbol Tarm1
Ensembl Gene ENSMUSG00000053338
Gene NameT cell-interacting, activating receptor on myeloid cells 1
Synonyms9930022N03Rik, Gm9904
MMRRC Submission 040745-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R3768 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location3486500-3502624 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3497581 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 69 (S69T)
Ref Sequence ENSEMBL: ENSMUSP00000145188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065703] [ENSMUST00000203020] [ENSMUST00000203821]
Predicted Effect probably benign
Transcript: ENSMUST00000065703
AA Change: S57T

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000069745
Gene: ENSMUSG00000053338
AA Change: S57T

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG_like 34 120 9.45e0 SMART
IG 131 217 5.28e-3 SMART
transmembrane domain 256 278 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203020
AA Change: S69T

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000145188
Gene: ENSMUSG00000053338
AA Change: S69T

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG_like 40 104 4.6e-3 SMART
IG_like 92 198 4.1e-2 SMART
IG 131 217 2.2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203821
AA Change: S69T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000145491
Gene: ENSMUSG00000053338
AA Change: S69T

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG_like 34 120 9.45e0 SMART
IG 131 217 5.28e-3 SMART
transmembrane domain 256 278 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik A G 7: 127,384,863 probably benign Het
Abca5 T C 11: 110,313,391 R353G probably benign Het
Ank1 A G 8: 23,116,186 D1153G possibly damaging Het
Ankrd12 T C 17: 65,985,720 Y906C probably benign Het
Apol9a G C 15: 77,404,396 T257S probably benign Het
Arhgap23 A T 11: 97,476,106 D1071V probably damaging Het
Arid4a A G 12: 71,067,119 K160R probably damaging Het
Atp8a2 T A 14: 60,044,336 H142L probably benign Het
B3gnt2 T C 11: 22,836,765 K141R probably damaging Het
Btbd7 G A 12: 102,795,192 P578L probably damaging Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Cmya5 A T 13: 93,096,693 I629K possibly damaging Het
Cnga4 A G 7: 105,407,680 N330S probably damaging Het
Cplx4 T C 18: 65,969,927 T41A probably benign Het
Cxcl15 A C 5: 90,801,444 D156A unknown Het
D630045J12Rik A G 6: 38,142,909 S1633P probably damaging Het
Dock10 T A 1: 80,532,368 N1581I probably damaging Het
Dock7 T C 4: 98,970,829 T1409A probably benign Het
Dscaml1 T A 9: 45,732,137 F1285I possibly damaging Het
Fgf10 G T 13: 118,781,547 V124F probably damaging Het
Ifna7 T C 4: 88,816,727 V167A probably damaging Het
Kctd19 T C 8: 105,396,480 T101A probably benign Het
Klf3 A G 5: 64,827,217 probably null Het
Krtap12-1 G T 10: 77,720,895 V91L probably benign Het
Lrp2 C T 2: 69,505,105 D1425N probably benign Het
Mgl2 T C 11: 70,135,833 L128P probably damaging Het
Mypn C A 10: 63,125,707 L1035F possibly damaging Het
Ncor2 A G 5: 125,028,687 V1613A probably damaging Het
Nlgn2 C T 11: 69,828,404 V207I possibly damaging Het
Olfr1378 A G 11: 50,969,558 D180G probably damaging Het
Olfr1384 T C 11: 49,513,773 I45T probably damaging Het
Olfr1420 G A 19: 11,896,312 G97D probably damaging Het
Olfr1426 A G 19: 12,087,940 I284T probably damaging Het
Osbpl3 G A 6: 50,348,002 P172L possibly damaging Het
Pabpc4 T A 4: 123,294,612 V338D probably damaging Het
Pdia6 T C 12: 17,270,456 V32A probably damaging Het
Pik3c3 T A 18: 30,333,273 S792R probably damaging Het
Pla2g5 C G 4: 138,801,435 C70S probably damaging Het
Pole4 G A 6: 82,622,114 R119C possibly damaging Het
Ppm1h G T 10: 122,904,122 L367F probably damaging Het
Ptpru C T 4: 131,808,424 C414Y probably damaging Het
Rhot2 T C 17: 25,840,547 D407G probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sap25 T A 5: 137,642,370 F171I probably damaging Het
Serpinb11 T C 1: 107,377,662 probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp36 T C 11: 118,263,052 K846R probably damaging Het
Zfp229 A T 17: 21,745,863 H358L probably damaging Het
Other mutations in Tarm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03229:Tarm1 APN 7 3496897 missense probably damaging 1.00
R0096:Tarm1 UTSW 7 3497551 missense probably benign 0.23
R0282:Tarm1 UTSW 7 3497490 missense probably damaging 1.00
R0308:Tarm1 UTSW 7 3496671 splice site probably benign
R4732:Tarm1 UTSW 7 3496900 nonsense probably null
R4733:Tarm1 UTSW 7 3496900 nonsense probably null
R4982:Tarm1 UTSW 7 3489096 missense probably damaging 1.00
R5336:Tarm1 UTSW 7 3497568 missense probably damaging 0.99
R6128:Tarm1 UTSW 7 3489204 missense probably benign 0.04
R6746:Tarm1 UTSW 7 3502462 missense probably benign 0.10
R6892:Tarm1 UTSW 7 3497490 missense probably damaging 1.00
R7003:Tarm1 UTSW 7 3497423 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGACCATCCTCACCTGTGAC -3'
(R):5'- ACACTGGTGTTATTTCTCAGGTGTC -3'

Sequencing Primer
(F):5'- CCAACAAGAAAAGGGCATTGCTG -3'
(R):5'- CAACTCAGGTGTTTGCGACCATG -3'
Posted On2015-03-25