Incidental Mutation 'R3769:Hoxb5'
ID 273181
Institutional Source Beutler Lab
Gene Symbol Hoxb5
Ensembl Gene ENSMUSG00000038700
Gene Name homeobox B5
Synonyms Hox-2.1
MMRRC Submission 040746-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3769 (G1)
Quality Score 96
Status Validated
Chromosome 11
Chromosomal Location 96194338-96196947 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 96194795 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 119 (D119G)
Ref Sequence ENSEMBL: ENSMUSP00000035423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000704] [ENSMUST00000049272] [ENSMUST00000173432]
AlphaFold P09079
Predicted Effect probably benign
Transcript: ENSMUST00000000704
SMART Domains Protein: ENSMUSP00000000704
Gene: ENSMUSG00000000690

DomainStartEndE-ValueType
low complexity region 54 71 N/A INTRINSIC
HOX 146 208 1.49e-25 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000049272
AA Change: D119G

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000035423
Gene: ENSMUSG00000038700
AA Change: D119G

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
low complexity region 89 103 N/A INTRINSIC
low complexity region 135 158 N/A INTRINSIC
HOX 194 256 1.63e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140952
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150698
Predicted Effect probably benign
Transcript: ENSMUST00000173432
SMART Domains Protein: ENSMUSP00000133281
Gene: ENSMUSG00000000690

DomainStartEndE-ValueType
low complexity region 54 71 N/A INTRINSIC
HOX 146 208 1.49e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190470
Meta Mutation Damage Score 0.1598 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Antp homeobox family and encodes a nuclear protein with a homeobox DNA-binding domain. It is included in a cluster of homeobox B genes located on chromosome 17. The encoded protein functions as a sequence-specific transcription factor that is involved in lung and gut development. Increased expression of this gene is associated with a distinct biologic subset of acute myeloid leukemia (AML) and the occurrence of bronchopulmonary sequestration (BPS) and congenital cystic adenomatoid malformation (CCAM) tissue. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile but exhibit a rostral shift of the shoulder girdle resulting in altered position of the forelimbs, and show variable anteriorizing homeotic transformations of cervicothoracic vertrebrae C6 through T1. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol9a G C 15: 77,288,596 (GRCm39) T257S probably benign Het
Arhgap23 A T 11: 97,366,932 (GRCm39) D1071V probably damaging Het
C3 C T 17: 57,512,303 (GRCm39) D1542N possibly damaging Het
Ccer1 G A 10: 97,530,414 (GRCm39) G359E probably damaging Het
Cdkal1 T C 13: 29,736,386 (GRCm39) probably null Het
Celf1 T C 2: 90,828,993 (GRCm39) V20A probably damaging Het
Cep350 G A 1: 155,828,950 (GRCm39) T318I probably damaging Het
Chn2 A G 6: 54,267,396 (GRCm39) D159G probably damaging Het
Chst5 T A 8: 112,616,513 (GRCm39) D369V possibly damaging Het
Cmya5 A T 13: 93,233,201 (GRCm39) I629K possibly damaging Het
Cplx4 T C 18: 66,102,998 (GRCm39) T41A probably benign Het
Ddx3x T C X: 13,156,808 (GRCm39) probably benign Het
Dock7 T C 4: 98,859,066 (GRCm39) T1409A probably benign Het
Dpy19l4 T C 4: 11,276,868 (GRCm39) probably null Het
Fgf10 G T 13: 118,918,083 (GRCm39) V124F probably damaging Het
Gm6356 C A 14: 6,971,774 (GRCm38) M120I probably benign Het
Gm7964 T A 7: 83,405,338 (GRCm39) V76D probably damaging Het
Gm826 A G 2: 160,169,165 (GRCm39) V48A unknown Het
Ifna7 T C 4: 88,734,964 (GRCm39) V167A probably damaging Het
Itgb2 T C 10: 77,385,802 (GRCm39) V255A possibly damaging Het
Klf3 A G 5: 64,984,560 (GRCm39) probably null Het
Mgl2 T C 11: 70,026,659 (GRCm39) L128P probably damaging Het
Or1ad6 A G 11: 50,860,385 (GRCm39) D180G probably damaging Het
Pdia6 T C 12: 17,320,457 (GRCm39) V32A probably damaging Het
Pex6 G T 17: 47,035,311 (GRCm39) probably null Het
Pla2g5 C G 4: 138,528,746 (GRCm39) C70S probably damaging Het
Pole4 G A 6: 82,599,095 (GRCm39) R119C possibly damaging Het
Polr2c G A 8: 95,586,928 (GRCm39) A65T probably damaging Het
Ptpru C T 4: 131,535,735 (GRCm39) C414Y probably damaging Het
Rhot2 T C 17: 26,059,521 (GRCm39) D407G probably benign Het
Scn5a G A 9: 119,381,142 (GRCm39) probably benign Het
Sh3rf3 A G 10: 58,820,013 (GRCm39) T275A probably benign Het
Slc27a2 A G 2: 126,409,718 (GRCm39) D300G possibly damaging Het
Slc35e1 A T 8: 73,245,714 (GRCm39) I155N possibly damaging Het
Slco1a4 A G 6: 141,785,357 (GRCm39) Y78H probably damaging Het
Snx15 T A 19: 6,173,984 (GRCm39) probably benign Het
Top1 A T 2: 160,563,442 (GRCm39) I758F probably damaging Het
U2surp A G 9: 95,375,750 (GRCm39) probably benign Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Ulk4 A G 9: 121,092,766 (GRCm39) V157A probably benign Het
Urgcp T C 11: 5,667,000 (GRCm39) Y446C probably damaging Het
Vps51 T C 19: 6,126,378 (GRCm39) T125A possibly damaging Het
Ypel1 T C 16: 16,927,532 (GRCm39) H20R probably benign Het
Zfp458 T A 13: 67,405,546 (GRCm39) I298F probably damaging Het
Zfp747l1 A G 7: 126,984,035 (GRCm39) probably benign Het
Other mutations in Hoxb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Hoxb5 APN 11 96,194,818 (GRCm39) missense possibly damaging 0.74
IGL02608:Hoxb5 APN 11 96,195,969 (GRCm39) unclassified probably benign
IGL02876:Hoxb5 APN 11 96,194,594 (GRCm39) missense probably damaging 0.98
R0233:Hoxb5 UTSW 11 96,195,853 (GRCm39) missense probably benign 0.04
R0233:Hoxb5 UTSW 11 96,195,853 (GRCm39) missense probably benign 0.04
R0536:Hoxb5 UTSW 11 96,194,854 (GRCm39) missense possibly damaging 0.86
R1962:Hoxb5 UTSW 11 96,194,918 (GRCm39) missense probably benign 0.19
R4250:Hoxb5 UTSW 11 96,194,854 (GRCm39) missense possibly damaging 0.86
R4457:Hoxb5 UTSW 11 96,194,546 (GRCm39) missense probably damaging 1.00
R6515:Hoxb5 UTSW 11 96,195,908 (GRCm39) missense probably damaging 1.00
R9756:Hoxb5 UTSW 11 96,194,449 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTACGGCTACAATTACAATGGG -3'
(R):5'- ATATCTGTGGAGTCTGCCCC -3'

Sequencing Primer
(F):5'- TGGGATGGATCTCAGCGTCAAC -3'
(R):5'- CAAGCTGGGGCTGCTTA -3'
Posted On 2015-03-25