Incidental Mutation 'R3769:Ppil2'
ID273190
Institutional Source Beutler Lab
Gene Symbol Ppil2
Ensembl Gene ENSMUSG00000022771
Gene Namepeptidylprolyl isomerase (cyclophilin)-like 2
Synonyms
MMRRC Submission 040746-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3769 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location17086555-17111257 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17109668 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 20 (H20R)
Ref Sequence ENSEMBL: ENSMUSP00000156086 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023455] [ENSMUST00000093336] [ENSMUST00000115719] [ENSMUST00000115721] [ENSMUST00000164458] [ENSMUST00000207116] [ENSMUST00000231245] [ENSMUST00000231451] [ENSMUST00000231681] [ENSMUST00000231712] [ENSMUST00000232481]
Predicted Effect probably benign
Transcript: ENSMUST00000023455
AA Change: H20R

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000023455
Gene: ENSMUSG00000022771
AA Change: H20R

DomainStartEndE-ValueType
Ubox 42 101 2.53e-14 SMART
Pfam:Pro_isomerase 281 433 1.3e-50 PFAM
low complexity region 493 507 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093336
SMART Domains Protein: ENSMUSP00000091026
Gene: ENSMUSG00000049916

DomainStartEndE-ValueType
low complexity region 118 131 N/A INTRINSIC
low complexity region 137 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115719
AA Change: H20R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000111384
Gene: ENSMUSG00000022771
AA Change: H20R

DomainStartEndE-ValueType
Ubox 42 101 2.53e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115721
AA Change: H20R

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000111386
Gene: ENSMUSG00000022771
AA Change: H20R

DomainStartEndE-ValueType
Ubox 42 101 2.53e-14 SMART
Pfam:Pro_isomerase 281 433 3.7e-53 PFAM
low complexity region 493 507 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134849
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153368
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153927
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156521
Predicted Effect probably benign
Transcript: ENSMUST00000164458
AA Change: H20R

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000131422
Gene: ENSMUSG00000022771
AA Change: H20R

DomainStartEndE-ValueType
Ubox 42 101 2.53e-14 SMART
Pfam:Pro_isomerase 281 433 1.3e-50 PFAM
low complexity region 493 507 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207116
Predicted Effect probably benign
Transcript: ENSMUST00000231245
AA Change: H20R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000231451
AA Change: H20R

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231587
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231635
Predicted Effect probably benign
Transcript: ENSMUST00000231681
Predicted Effect probably benign
Transcript: ENSMUST00000231712
AA Change: H20R

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000232481
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232510
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232615
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cyclophilin family of peptidylprolyl isomerases. The cyclophilins are a highly conserved ubiquitous family, members of which play an important role in protein folding, immunosuppression by cyclosporin A, and infection of HIV-1 virions. This protein interacts with the proteinase inhibitor eglin c and is localized in the nucleus. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik A G 7: 127,384,863 probably benign Het
Apol9a G C 15: 77,404,396 T257S probably benign Het
Arhgap23 A T 11: 97,476,106 D1071V probably damaging Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Ccer1 G A 10: 97,694,552 G359E probably damaging Het
Cdkal1 T C 13: 29,552,403 probably null Het
Celf1 T C 2: 90,998,648 V20A probably damaging Het
Cep350 G A 1: 155,953,204 T318I probably damaging Het
Chn2 A G 6: 54,290,411 D159G probably damaging Het
Chst5 T A 8: 111,889,881 D369V possibly damaging Het
Cmya5 A T 13: 93,096,693 I629K possibly damaging Het
Cplx4 T C 18: 65,969,927 T41A probably benign Het
Ddx3x T C X: 13,290,569 probably benign Het
Dock7 T C 4: 98,970,829 T1409A probably benign Het
Dpy19l4 T C 4: 11,276,868 probably null Het
Fgf10 G T 13: 118,781,547 V124F probably damaging Het
Gm6356 C A 14: 6,971,774 M120I probably benign Het
Gm7964 T A 7: 83,756,130 V76D probably damaging Het
Gm826 A G 2: 160,327,245 V48A unknown Het
Hoxb5 A G 11: 96,303,969 D119G possibly damaging Het
Ifna7 T C 4: 88,816,727 V167A probably damaging Het
Itgb2 T C 10: 77,549,968 V255A possibly damaging Het
Klf3 A G 5: 64,827,217 probably null Het
Mgl2 T C 11: 70,135,833 L128P probably damaging Het
Olfr1378 A G 11: 50,969,558 D180G probably damaging Het
Pdia6 T C 12: 17,270,456 V32A probably damaging Het
Pex6 G T 17: 46,724,385 probably null Het
Pla2g5 C G 4: 138,801,435 C70S probably damaging Het
Pole4 G A 6: 82,622,114 R119C possibly damaging Het
Polr2c G A 8: 94,860,300 A65T probably damaging Het
Ptpru C T 4: 131,808,424 C414Y probably damaging Het
Rhot2 T C 17: 25,840,547 D407G probably benign Het
Scn5a G A 9: 119,552,076 probably benign Het
Sh3rf3 A G 10: 58,984,191 T275A probably benign Het
Slc27a2 A G 2: 126,567,798 D300G possibly damaging Het
Slc35e1 A T 8: 72,491,870 I155N possibly damaging Het
Slco1a4 A G 6: 141,839,631 Y78H probably damaging Het
Snx15 T A 19: 6,123,954 probably benign Het
Top1 A T 2: 160,721,522 I758F probably damaging Het
U2surp A G 9: 95,493,697 probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ulk4 A G 9: 121,263,700 V157A probably benign Het
Urgcp T C 11: 5,717,000 Y446C probably damaging Het
Vps51 T C 19: 6,076,348 T125A possibly damaging Het
Zfp458 T A 13: 67,257,482 I298F probably damaging Het
Other mutations in Ppil2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Ppil2 APN 16 17091212 missense probably damaging 1.00
IGL02392:Ppil2 APN 16 17088838 missense probably benign
IGL02559:Ppil2 APN 16 17109651 missense possibly damaging 0.80
IGL02708:Ppil2 APN 16 17106008 missense probably benign 0.03
IGL02724:Ppil2 APN 16 17103602 missense probably benign 0.08
zagnut UTSW 16 17096041 missense possibly damaging 0.62
R0592:Ppil2 UTSW 16 17107219 missense probably benign
R0975:Ppil2 UTSW 16 17107213 missense probably benign 0.00
R1258:Ppil2 UTSW 16 17106053 missense probably damaging 1.00
R1677:Ppil2 UTSW 16 17103610 missense probably damaging 1.00
R1728:Ppil2 UTSW 16 17089419 unclassified probably benign
R1739:Ppil2 UTSW 16 17089419 unclassified probably benign
R1784:Ppil2 UTSW 16 17089419 unclassified probably benign
R1853:Ppil2 UTSW 16 17107223 missense probably benign 0.00
R3608:Ppil2 UTSW 16 17092290 nonsense probably null
R4445:Ppil2 UTSW 16 17103600 nonsense probably null
R4518:Ppil2 UTSW 16 17096041 missense possibly damaging 0.62
R5066:Ppil2 UTSW 16 17109675 missense probably benign 0.03
R5842:Ppil2 UTSW 16 17094987 missense possibly damaging 0.66
R6013:Ppil2 UTSW 16 17100265 missense probably damaging 1.00
R6415:Ppil2 UTSW 16 17103574 critical splice donor site probably null
X0010:Ppil2 UTSW 16 17095037 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- TCCTAAGGAAAAGGCCTGAACTTG -3'
(R):5'- TCCTTCTGGACAAGGTGCTG -3'

Sequencing Primer
(F):5'- AAAAGGCCTGAACTTGAAAGAG -3'
(R):5'- CTGGACAAGGTGCTGTTGATG -3'
Posted On2015-03-25