Incidental Mutation 'R3770:Vmn2r81'
ID273223
Institutional Source Beutler Lab
Gene Symbol Vmn2r81
Ensembl Gene ENSMUSG00000055515
Gene Namevomeronasal 2, receptor 81
SynonymsV2rf2, EC1-VR2, pheromone recepter
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R3770 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location79247777-79294535 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79270600 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 471 (I471F)
Ref Sequence ENSEMBL: ENSMUSP00000020547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020547]
Predicted Effect probably damaging
Transcript: ENSMUST00000020547
AA Change: I471F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020547
Gene: ENSMUSG00000055515
AA Change: I471F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 79 474 7.7e-37 PFAM
Pfam:NCD3G 517 570 8.9e-21 PFAM
Pfam:7tm_3 603 838 6.1e-50 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit vomeronasal sensory neuron axons that spread out diffusely over the posterior accessory olfactory bulb and extend abnormally into the anterior olfactory bulb. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik A G 7: 127,384,863 probably benign Het
Acox1 T C 11: 116,174,387 D578G probably damaging Het
Adgrb1 T A 15: 74,588,308 I543N probably damaging Het
Agbl1 T C 7: 76,425,929 probably null Het
Ano1 A G 7: 144,595,569 Y852H probably damaging Het
Apol9a G C 15: 77,404,396 T257S probably benign Het
Arhgap23 A T 11: 97,476,106 D1071V probably damaging Het
Atp1a1 T C 3: 101,581,194 D842G probably benign Het
Brd7 A T 8: 88,339,407 probably null Het
Btbd7 G A 12: 102,795,192 P578L probably damaging Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Cfap54 C T 10: 92,878,536 M2660I unknown Het
Dock7 T C 4: 98,970,829 T1409A probably benign Het
Exoc3l4 A G 12: 111,425,555 D410G probably benign Het
Foxk2 CGGGGGG CGGGGGGGGG 11: 121,260,491 probably benign Het
Herc2 A G 7: 56,165,007 I2703V probably benign Het
Ifna7 T C 4: 88,816,727 V167A probably damaging Het
Iqcg G A 16: 33,050,008 silent Het
Klf3 A G 5: 64,827,217 probably null Het
Krtap12-1 G T 10: 77,720,895 V91L probably benign Het
Lipo5 G T 19: 33,467,800 T123N unknown Het
Macf1 A G 4: 123,374,767 S4689P probably damaging Het
Map3k5 T A 10: 20,025,019 V313D probably damaging Het
Mypn C A 10: 63,125,707 L1035F possibly damaging Het
Neurl1a T C 19: 47,239,889 L58P probably damaging Het
Olfr1110 C T 2: 87,135,814 C169Y probably damaging Het
Pla2g5 C G 4: 138,801,435 C70S probably damaging Het
Pole4 G A 6: 82,622,114 R119C possibly damaging Het
Ppm1h G T 10: 122,904,122 L367F probably damaging Het
Ptpru C T 4: 131,808,424 C414Y probably damaging Het
Rasal3 A T 17: 32,392,151 L912Q probably damaging Het
Reln C T 5: 21,948,566 V2247M probably damaging Het
Rhot2 T C 17: 25,840,547 D407G probably benign Het
Rreb1 C T 13: 37,929,603 R313W possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scn11a T A 9: 119,784,049 D825V probably damaging Het
Slc12a3 A G 8: 94,353,040 H832R probably benign Het
Slc27a2 A G 2: 126,567,798 D300G possibly damaging Het
Sos1 A G 17: 80,398,308 V1278A probably damaging Het
Sstr3 C A 15: 78,540,377 V57L probably damaging Het
Tex2 T A 11: 106,544,252 R783W unknown Het
Tjp2 A T 19: 24,100,826 I901N probably benign Het
Top1 A T 2: 160,721,522 I758F probably damaging Het
Trim41 T C 11: 48,809,084 E98G possibly damaging Het
Vmn2r65 A T 7: 84,940,415 N764K probably damaging Het
Wdr25 G A 12: 108,898,420 V164M probably damaging Het
Zdhhc13 T A 7: 48,802,944 L5M probably damaging Het
Other mutations in Vmn2r81
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:Vmn2r81 APN 10 79247997 missense probably benign 0.20
IGL02255:Vmn2r81 APN 10 79247972 nonsense probably null
IGL02901:Vmn2r81 APN 10 79270730 missense probably damaging 0.98
R0383:Vmn2r81 UTSW 10 79293447 missense possibly damaging 0.95
R0555:Vmn2r81 UTSW 10 79293449 missense probably damaging 1.00
R0715:Vmn2r81 UTSW 10 79268600 missense probably damaging 1.00
R0967:Vmn2r81 UTSW 10 79248023 splice site probably benign
R1438:Vmn2r81 UTSW 10 79293857 missense probably benign 0.00
R1468:Vmn2r81 UTSW 10 79293662 missense probably damaging 1.00
R1468:Vmn2r81 UTSW 10 79293662 missense probably damaging 1.00
R1589:Vmn2r81 UTSW 10 79293024 missense probably damaging 0.99
R1671:Vmn2r81 UTSW 10 79267431 missense probably benign 0.04
R1672:Vmn2r81 UTSW 10 79268278 missense probably damaging 0.99
R1728:Vmn2r81 UTSW 10 79270655 missense probably benign 0.08
R1784:Vmn2r81 UTSW 10 79270655 missense probably benign 0.08
R1931:Vmn2r81 UTSW 10 79293494 missense probably damaging 0.98
R1934:Vmn2r81 UTSW 10 79247794 start codon destroyed probably null 0.71
R1944:Vmn2r81 UTSW 10 79293737 missense probably damaging 1.00
R2102:Vmn2r81 UTSW 10 79293500 missense probably damaging 0.97
R2190:Vmn2r81 UTSW 10 79268251 missense possibly damaging 0.67
R2392:Vmn2r81 UTSW 10 79274682 missense probably damaging 1.00
R4551:Vmn2r81 UTSW 10 79268407 missense possibly damaging 0.95
R4629:Vmn2r81 UTSW 10 79267442 missense probably damaging 0.99
R4691:Vmn2r81 UTSW 10 79293377 nonsense probably null
R4829:Vmn2r81 UTSW 10 79247801 missense possibly damaging 0.48
R4914:Vmn2r81 UTSW 10 79270523 missense probably null 1.00
R4996:Vmn2r81 UTSW 10 79293413 missense probably benign 0.04
R5242:Vmn2r81 UTSW 10 79293475 nonsense probably null
R5253:Vmn2r81 UTSW 10 79247986 missense probably benign 0.00
R5925:Vmn2r81 UTSW 10 79247803 missense probably damaging 1.00
R6169:Vmn2r81 UTSW 10 79268548 missense probably benign
R6270:Vmn2r81 UTSW 10 79293815 missense probably benign
R6525:Vmn2r81 UTSW 10 79293726 missense probably benign 0.11
R6813:Vmn2r81 UTSW 10 79268605 missense probably benign 0.00
R6886:Vmn2r81 UTSW 10 79268154 missense possibly damaging 0.90
X0067:Vmn2r81 UTSW 10 79293043 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- ACACGATACATTTATAGCCAGGAC -3'
(R):5'- TGTGGTCAATAATACCAACCAAGAG -3'

Sequencing Primer
(F):5'- GCCAGGACATAACTTCGTATTTG -3'
(R):5'- TACCAACCAAGAGTCATTACATCCAG -3'
Posted On2015-03-25