Incidental Mutation 'R3770:Btbd7'
ID273234
Institutional Source Beutler Lab
Gene Symbol Btbd7
Ensembl Gene ENSMUSG00000041702
Gene NameBTB (POZ) domain containing 7
SynonymsFUP1, E130118E17Rik, 5730507E09Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.351) question?
Stock #R3770 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location102780797-102878471 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 102795192 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 578 (P578L)
Ref Sequence ENSEMBL: ENSMUSP00000152426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045652] [ENSMUST00000223554]
Predicted Effect probably damaging
Transcript: ENSMUST00000045652
AA Change: P578L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046951
Gene: ENSMUSG00000041702
AA Change: P578L

DomainStartEndE-ValueType
BTB 142 244 1.57e-13 SMART
BTB 247 397 2.23e-4 SMART
BACK 402 538 1.49e-4 SMART
low complexity region 626 640 N/A INTRINSIC
low complexity region 756 771 N/A INTRINSIC
low complexity region 783 792 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
low complexity region 839 850 N/A INTRINSIC
low complexity region 1076 1088 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000223554
AA Change: P578L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik A G 7: 127,384,863 probably benign Het
Acox1 T C 11: 116,174,387 D578G probably damaging Het
Adgrb1 T A 15: 74,588,308 I543N probably damaging Het
Agbl1 T C 7: 76,425,929 probably null Het
Ano1 A G 7: 144,595,569 Y852H probably damaging Het
Apol9a G C 15: 77,404,396 T257S probably benign Het
Arhgap23 A T 11: 97,476,106 D1071V probably damaging Het
Atp1a1 T C 3: 101,581,194 D842G probably benign Het
Brd7 A T 8: 88,339,407 probably null Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Cfap54 C T 10: 92,878,536 M2660I unknown Het
Dock7 T C 4: 98,970,829 T1409A probably benign Het
Exoc3l4 A G 12: 111,425,555 D410G probably benign Het
Foxk2 CGGGGGG CGGGGGGGGG 11: 121,260,491 probably benign Het
Herc2 A G 7: 56,165,007 I2703V probably benign Het
Ifna7 T C 4: 88,816,727 V167A probably damaging Het
Iqcg G A 16: 33,050,008 silent Het
Klf3 A G 5: 64,827,217 probably null Het
Krtap12-1 G T 10: 77,720,895 V91L probably benign Het
Lipo5 G T 19: 33,467,800 T123N unknown Het
Macf1 A G 4: 123,374,767 S4689P probably damaging Het
Map3k5 T A 10: 20,025,019 V313D probably damaging Het
Mypn C A 10: 63,125,707 L1035F possibly damaging Het
Neurl1a T C 19: 47,239,889 L58P probably damaging Het
Olfr1110 C T 2: 87,135,814 C169Y probably damaging Het
Pla2g5 C G 4: 138,801,435 C70S probably damaging Het
Pole4 G A 6: 82,622,114 R119C possibly damaging Het
Ppm1h G T 10: 122,904,122 L367F probably damaging Het
Ptpru C T 4: 131,808,424 C414Y probably damaging Het
Rasal3 A T 17: 32,392,151 L912Q probably damaging Het
Reln C T 5: 21,948,566 V2247M probably damaging Het
Rhot2 T C 17: 25,840,547 D407G probably benign Het
Rreb1 C T 13: 37,929,603 R313W possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scn11a T A 9: 119,784,049 D825V probably damaging Het
Slc12a3 A G 8: 94,353,040 H832R probably benign Het
Slc27a2 A G 2: 126,567,798 D300G possibly damaging Het
Sos1 A G 17: 80,398,308 V1278A probably damaging Het
Sstr3 C A 15: 78,540,377 V57L probably damaging Het
Tex2 T A 11: 106,544,252 R783W unknown Het
Tjp2 A T 19: 24,100,826 I901N probably benign Het
Top1 A T 2: 160,721,522 I758F probably damaging Het
Trim41 T C 11: 48,809,084 E98G possibly damaging Het
Vmn2r65 A T 7: 84,940,415 N764K probably damaging Het
Vmn2r81 A T 10: 79,270,600 I471F probably damaging Het
Wdr25 G A 12: 108,898,420 V164M probably damaging Het
Zdhhc13 T A 7: 48,802,944 L5M probably damaging Het
Other mutations in Btbd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02047:Btbd7 APN 12 102793779 missense probably benign 0.10
IGL02899:Btbd7 APN 12 102837662 missense probably damaging 1.00
IGL03204:Btbd7 APN 12 102807980 nonsense probably null
H8562:Btbd7 UTSW 12 102788302 missense probably benign 0.26
IGL03050:Btbd7 UTSW 12 102812806 missense probably benign 0.03
R1262:Btbd7 UTSW 12 102787951 missense probably benign
R1423:Btbd7 UTSW 12 102785475 missense possibly damaging 0.49
R1437:Btbd7 UTSW 12 102788090 missense possibly damaging 0.59
R1636:Btbd7 UTSW 12 102793851 missense probably damaging 1.00
R1641:Btbd7 UTSW 12 102790775 missense probably damaging 1.00
R1722:Btbd7 UTSW 12 102812654 missense possibly damaging 0.96
R1921:Btbd7 UTSW 12 102793796 missense probably benign 0.01
R2021:Btbd7 UTSW 12 102790709 missense probably damaging 1.00
R2180:Btbd7 UTSW 12 102785897 missense probably damaging 1.00
R3768:Btbd7 UTSW 12 102795192 missense probably damaging 1.00
R3786:Btbd7 UTSW 12 102838152 missense probably benign 0.22
R4396:Btbd7 UTSW 12 102785293 missense probably benign 0.00
R4809:Btbd7 UTSW 12 102793744 critical splice donor site probably null
R4910:Btbd7 UTSW 12 102808048 missense probably damaging 0.98
R4915:Btbd7 UTSW 12 102837787 nonsense probably null
R5054:Btbd7 UTSW 12 102838212 missense probably benign 0.02
R5276:Btbd7 UTSW 12 102838392 missense probably benign 0.00
R5387:Btbd7 UTSW 12 102837785 missense probably damaging 0.99
R5665:Btbd7 UTSW 12 102785197 missense probably benign
X0024:Btbd7 UTSW 12 102812686 nonsense probably null
X0025:Btbd7 UTSW 12 102811164 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGTAACAATCTGCAAGGCCAG -3'
(R):5'- GTATCGTAGTGCTGCATATATCTTG -3'

Sequencing Primer
(F):5'- CCAGGAGGTAAAATGCATCTTAAG -3'
(R):5'- GACATGCTTCCTACAGCA -3'
Posted On2015-03-25