Incidental Mutation 'R3770:Sstr3'
ID 273240
Institutional Source Beutler Lab
Gene Symbol Sstr3
Ensembl Gene ENSMUSG00000044933
Gene Name somatostatin receptor 3
Synonyms Smstr-3, Smstr3, sst3
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3770 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 78421208-78428885 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 78424577 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 57 (V57L)
Ref Sequence ENSEMBL: ENSMUSP00000058040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053239] [ENSMUST00000230400]
AlphaFold P30935
Predicted Effect probably damaging
Transcript: ENSMUST00000053239
AA Change: V57L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000058040
Gene: ENSMUSG00000044933
AA Change: V57L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 53 291 1.9e-8 PFAM
Pfam:7TM_GPCR_Srsx 56 337 3.5e-15 PFAM
Pfam:7tm_1 62 322 6.3e-60 PFAM
Pfam:7TM_GPCR_Srv 121 337 9.5e-8 PFAM
coiled coil region 355 388 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000230400
AA Change: V57L

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the somatostatin receptor protein family. Somatostatins are peptide hormones that regulate diverse cellular functions such as neurotransmission, cell proliferation, and endocrine signaling as well as inhibiting the release of many hormones and other secretory proteins. Somatostatin has two active forms of 14 and 28 amino acids. The biological effects of somatostatins are mediated by a family of G-protein coupled somatostatin receptors that are expressed in a tissue-specific manner. Somatostatin receptors form homodimers and heterodimers with other members of the superfamily as well as with other G-protein coupled receptors and receptor tyrosine kinases. This protein is functionally coupled to adenylyl cyclase. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox1 T C 11: 116,065,213 (GRCm39) D578G probably damaging Het
Adgrb1 T A 15: 74,460,157 (GRCm39) I543N probably damaging Het
Agbl1 T C 7: 76,075,677 (GRCm39) probably null Het
Ano1 A G 7: 144,149,306 (GRCm39) Y852H probably damaging Het
Apol9a G C 15: 77,288,596 (GRCm39) T257S probably benign Het
Arhgap23 A T 11: 97,366,932 (GRCm39) D1071V probably damaging Het
Atp1a1 T C 3: 101,488,510 (GRCm39) D842G probably benign Het
Brd7 A T 8: 89,066,035 (GRCm39) probably null Het
Btbd7 G A 12: 102,761,451 (GRCm39) P578L probably damaging Het
C3 C T 17: 57,512,303 (GRCm39) D1542N possibly damaging Het
Cfap54 C T 10: 92,714,398 (GRCm39) M2660I unknown Het
Dock7 T C 4: 98,859,066 (GRCm39) T1409A probably benign Het
Exoc3l4 A G 12: 111,391,989 (GRCm39) D410G probably benign Het
Foxk2 CGGGGGG CGGGGGGGGG 11: 121,151,317 (GRCm39) probably benign Het
Herc2 A G 7: 55,814,755 (GRCm39) I2703V probably benign Het
Ifna7 T C 4: 88,734,964 (GRCm39) V167A probably damaging Het
Iqcg G A 16: 32,870,378 (GRCm39) silent Het
Klf3 A G 5: 64,984,560 (GRCm39) probably null Het
Krtap12-1 G T 10: 77,556,729 (GRCm39) V91L probably benign Het
Lipo5 G T 19: 33,445,200 (GRCm39) T123N unknown Het
Macf1 A G 4: 123,268,560 (GRCm39) S4689P probably damaging Het
Map3k5 T A 10: 19,900,765 (GRCm39) V313D probably damaging Het
Mypn C A 10: 62,961,486 (GRCm39) L1035F possibly damaging Het
Neurl1a T C 19: 47,228,328 (GRCm39) L58P probably damaging Het
Or5aq1 C T 2: 86,966,158 (GRCm39) C169Y probably damaging Het
Pla2g5 C G 4: 138,528,746 (GRCm39) C70S probably damaging Het
Pole4 G A 6: 82,599,095 (GRCm39) R119C possibly damaging Het
Ppm1h G T 10: 122,740,027 (GRCm39) L367F probably damaging Het
Ptpru C T 4: 131,535,735 (GRCm39) C414Y probably damaging Het
Rasal3 A T 17: 32,611,125 (GRCm39) L912Q probably damaging Het
Reln C T 5: 22,153,564 (GRCm39) V2247M probably damaging Het
Rhot2 T C 17: 26,059,521 (GRCm39) D407G probably benign Het
Rreb1 C T 13: 38,113,579 (GRCm39) R313W possibly damaging Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Scn11a T A 9: 119,613,115 (GRCm39) D825V probably damaging Het
Slc12a3 A G 8: 95,079,668 (GRCm39) H832R probably benign Het
Slc27a2 A G 2: 126,409,718 (GRCm39) D300G possibly damaging Het
Sos1 A G 17: 80,705,737 (GRCm39) V1278A probably damaging Het
Tex2 T A 11: 106,435,078 (GRCm39) R783W unknown Het
Tjp2 A T 19: 24,078,190 (GRCm39) I901N probably benign Het
Top1 A T 2: 160,563,442 (GRCm39) I758F probably damaging Het
Trim41 T C 11: 48,699,911 (GRCm39) E98G possibly damaging Het
Vmn2r65 A T 7: 84,589,623 (GRCm39) N764K probably damaging Het
Vmn2r81 A T 10: 79,106,434 (GRCm39) I471F probably damaging Het
Wdr25 G A 12: 108,864,346 (GRCm39) V164M probably damaging Het
Zdhhc13 T A 7: 48,452,692 (GRCm39) L5M probably damaging Het
Zfp747l1 A G 7: 126,984,035 (GRCm39) probably benign Het
Other mutations in Sstr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Sstr3 APN 15 78,424,667 (GRCm39) missense probably benign 0.00
R0442:Sstr3 UTSW 15 78,424,597 (GRCm39) missense probably damaging 0.99
R1714:Sstr3 UTSW 15 78,424,473 (GRCm39) missense probably damaging 1.00
R1865:Sstr3 UTSW 15 78,424,168 (GRCm39) missense probably damaging 1.00
R2008:Sstr3 UTSW 15 78,424,711 (GRCm39) missense probably benign 0.14
R2351:Sstr3 UTSW 15 78,424,121 (GRCm39) missense probably benign 0.01
R3023:Sstr3 UTSW 15 78,424,187 (GRCm39) missense probably damaging 0.99
R3024:Sstr3 UTSW 15 78,424,187 (GRCm39) missense probably damaging 0.99
R4399:Sstr3 UTSW 15 78,424,324 (GRCm39) missense probably damaging 1.00
R4724:Sstr3 UTSW 15 78,423,897 (GRCm39) nonsense probably null
R6181:Sstr3 UTSW 15 78,423,661 (GRCm39) missense probably benign
R6247:Sstr3 UTSW 15 78,423,788 (GRCm39) missense probably damaging 0.99
R7450:Sstr3 UTSW 15 78,424,043 (GRCm39) missense probably damaging 1.00
R7578:Sstr3 UTSW 15 78,424,717 (GRCm39) missense probably benign
R7793:Sstr3 UTSW 15 78,424,588 (GRCm39) missense probably damaging 1.00
R8336:Sstr3 UTSW 15 78,424,693 (GRCm39) missense probably damaging 1.00
R9263:Sstr3 UTSW 15 78,423,792 (GRCm39) missense probably damaging 1.00
R9264:Sstr3 UTSW 15 78,423,792 (GRCm39) missense probably damaging 1.00
R9265:Sstr3 UTSW 15 78,423,792 (GRCm39) missense probably damaging 1.00
X0026:Sstr3 UTSW 15 78,423,574 (GRCm39) missense possibly damaging 0.57
Z1177:Sstr3 UTSW 15 78,423,503 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTGGTTGATGCCATCCACG -3'
(R):5'- GATCCTCATCTCAGCCATGG -3'

Sequencing Primer
(F):5'- CGGCACATGAGAGATCCG -3'
(R):5'- AGCCATGGCCACTGTTAC -3'
Posted On 2015-03-25