Incidental Mutation 'R3771:Polr3c'
ID273261
Institutional Source Beutler Lab
Gene Symbol Polr3c
Ensembl Gene ENSMUSG00000028099
Gene Namepolymerase (RNA) III (DNA directed) polypeptide C
Synonyms4933407E01Rik, RPC62, RPC3
MMRRC Submission 040747-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R3771 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location96711490-96727628 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 96725854 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 43 (T43S)
Ref Sequence ENSEMBL: ENSMUSP00000122435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029740] [ENSMUST00000029741] [ENSMUST00000125183] [ENSMUST00000141377] [ENSMUST00000154679] [ENSMUST00000199051]
Predicted Effect probably benign
Transcript: ENSMUST00000029740
SMART Domains Protein: ENSMUSP00000029740
Gene: ENSMUSG00000028098

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
RING 229 269 1.14e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000029741
AA Change: T43S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000029741
Gene: ENSMUSG00000028099
AA Change: T43S

DomainStartEndE-ValueType
Pfam:HTH_9 7 68 9.4e-26 PFAM
Pfam:RNA_pol_Rpc82 146 344 7.6e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083735
Predicted Effect possibly damaging
Transcript: ENSMUST00000125183
AA Change: T43S

PolyPhen 2 Score 0.682 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000123513
Gene: ENSMUSG00000028099
AA Change: T43S

DomainStartEndE-ValueType
Pfam:HTH_9 7 68 4.6e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128918
SMART Domains Protein: ENSMUSP00000119236
Gene: ENSMUSG00000028099

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpc82 20 180 5.9e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137009
Predicted Effect probably damaging
Transcript: ENSMUST00000141377
AA Change: T43S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000115300
Gene: ENSMUSG00000028099
AA Change: T43S

DomainStartEndE-ValueType
Pfam:HTH_9 7 68 3.3e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000154679
AA Change: T43S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000122435
Gene: ENSMUSG00000028099
AA Change: T43S

DomainStartEndE-ValueType
Pfam:HTH_9 7 68 1.6e-26 PFAM
Pfam:RNA_pol_Rpc82 146 344 7.6e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197075
Predicted Effect probably benign
Transcript: ENSMUST00000199051
SMART Domains Protein: ENSMUSP00000143321
Gene: ENSMUSG00000028098

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:zf-RING_3 18 49 4.5e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199974
Meta Mutation Damage Score 0.02 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,931,196 Y377H probably damaging Het
1810041L15Rik A T 15: 84,406,685 Y120* probably null Het
Aanat G T 11: 116,596,871 G132V probably damaging Het
Abcb11 T A 2: 69,329,376 probably benign Het
Adam26b T A 8: 43,520,714 D417V probably damaging Het
Ank1 T C 8: 23,123,897 S1482P probably benign Het
Armc2 C T 10: 41,922,227 V768M probably damaging Het
Ascc3 C T 10: 50,720,718 probably benign Het
Birc6 T A 17: 74,618,429 probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdh12 A T 15: 21,578,554 probably benign Het
Chd1 A G 17: 17,374,651 D16G probably damaging Het
Clstn2 A G 9: 97,582,562 I180T probably damaging Het
Cxcr6 A G 9: 123,810,485 I184V probably benign Het
Dagla G A 19: 10,248,467 P778S possibly damaging Het
Ddx19b T C 8: 111,020,981 K107R probably benign Het
Dpyd G A 3: 119,412,278 probably null Het
Elf1 T C 14: 79,567,210 V105A possibly damaging Het
Fam13a T G 6: 58,987,186 K87T probably benign Het
Fap C A 2: 62,533,010 S359I probably damaging Het
Fbxo39 T C 11: 72,317,215 I131T possibly damaging Het
Fmn1 T G 2: 113,582,118 S996A probably damaging Het
Gm5866 T C 5: 52,582,746 noncoding transcript Het
Hmcn2 C T 2: 31,360,896 T790M probably damaging Het
Irf2bp2 T C 8: 126,591,811 K339E probably damaging Het
Kat6b A G 14: 21,517,098 D75G probably damaging Het
Kcnab3 A G 11: 69,328,563 T127A probably damaging Het
Kdm5b G T 1: 134,613,345 C725F probably damaging Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Lrrn3 T A 12: 41,452,870 I483L probably damaging Het
Man2c1 C A 9: 57,140,377 probably benign Het
Med23 G T 10: 24,902,201 G810C probably damaging Het
Nhlrc4 T A 17: 25,943,393 K127* probably null Het
Numb T C 12: 83,799,576 D344G probably damaging Het
Nup210l T G 3: 90,119,894 Y194* probably null Het
Ogg1 T C 6: 113,333,843 V317A possibly damaging Het
Olfr822 A G 10: 130,075,274 Y288C probably damaging Het
Olfr97 T A 17: 37,231,465 I302F possibly damaging Het
Pclo A T 5: 14,539,408 probably null Het
Pnpt1 T C 11: 29,138,174 M195T probably benign Het
Ptprs T C 17: 56,428,978 T152A possibly damaging Het
Rasl10b A T 11: 83,418,523 T134S probably benign Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf39 T C 17: 36,947,229 W96R probably damaging Het
Ros1 G T 10: 52,128,991 A949E probably damaging Het
Rwdd2a A C 9: 86,574,161 N130T possibly damaging Het
Scn9a T C 2: 66,483,648 N1909D probably benign Het
Ska3 C T 14: 57,810,077 V334I probably benign Het
Srebf2 A G 15: 82,182,108 K579R probably benign Het
Sun1 A G 5: 139,238,820 probably benign Het
Tc2n T A 12: 101,694,574 Q133L possibly damaging Het
Tecta T C 9: 42,330,996 T2094A probably damaging Het
Tex2 T C 11: 106,546,894 D650G unknown Het
Trio A G 15: 27,748,091 S2492P probably damaging Het
Ttn T C 2: 76,771,367 T16872A probably benign Het
Ugcg T C 4: 59,189,690 F16S probably benign Het
Usp16 T C 16: 87,458,683 M1T probably null Het
Vmn1r60 C A 7: 5,544,711 C130F possibly damaging Het
Vmn2r101 A G 17: 19,589,657 D235G probably benign Het
Vpreb3 A T 10: 75,939,966 V26E probably benign Het
Vps39 C T 2: 120,342,016 V179I possibly damaging Het
Xrn2 T C 2: 147,061,287 V765A probably benign Het
Zfp251 A G 15: 76,853,636 I414T possibly damaging Het
Zfp426 A T 9: 20,473,117 probably null Het
Zfp61 T C 7: 24,295,981 M1V probably null Het
Other mutations in Polr3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01734:Polr3c APN 3 96713520 missense probably damaging 1.00
IGL01904:Polr3c APN 3 96716665 critical splice donor site probably null
IGL01964:Polr3c APN 3 96711975 unclassified probably benign
IGL02640:Polr3c APN 3 96716686 missense probably damaging 0.98
IGL02955:Polr3c APN 3 96714312 missense probably damaging 1.00
IGL03129:Polr3c APN 3 96719454 splice site probably benign
IGL03263:Polr3c APN 3 96714251 splice site probably benign
R0503:Polr3c UTSW 3 96713636 splice site probably null
R0800:Polr3c UTSW 3 96719311 missense probably damaging 0.99
R0881:Polr3c UTSW 3 96723847 missense probably damaging 0.99
R1763:Polr3c UTSW 3 96713595 missense probably damaging 1.00
R1931:Polr3c UTSW 3 96719298 missense probably damaging 1.00
R1932:Polr3c UTSW 3 96719298 missense probably damaging 1.00
R1994:Polr3c UTSW 3 96714373 splice site probably null
R4116:Polr3c UTSW 3 96715244 missense probably damaging 1.00
R4614:Polr3c UTSW 3 96716471 missense probably benign 0.00
R4732:Polr3c UTSW 3 96723661 missense probably damaging 1.00
R4733:Polr3c UTSW 3 96723661 missense probably damaging 1.00
R5057:Polr3c UTSW 3 96712057 missense probably damaging 0.98
R5058:Polr3c UTSW 3 96723517 missense probably benign 0.01
R5756:Polr3c UTSW 3 96714134 missense probably damaging 1.00
R6005:Polr3c UTSW 3 96719468 missense possibly damaging 0.96
R6009:Polr3c UTSW 3 96713614 missense probably damaging 1.00
R6580:Polr3c UTSW 3 96727343 splice site probably null
R7003:Polr3c UTSW 3 96723638 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CACGGGGCCTAAGTACAATACC -3'
(R):5'- TGTGAAGAGAACTCATGGCATG -3'

Sequencing Primer
(F):5'- GGGGCCTAAGTACAATACCACACC -3'
(R):5'- GAGAACTCATGGCATGGTTTTTAC -3'
Posted On2015-03-25