Incidental Mutation 'R3771:Lrrn3'
ID273299
Institutional Source Beutler Lab
Gene Symbol Lrrn3
Ensembl Gene ENSMUSG00000036295
Gene Nameleucine rich repeat protein 3, neuronal
SynonymsNLRR-3
MMRRC Submission 040747-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.230) question?
Stock #R3771 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location41451668-41486431 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 41452870 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 483 (I483L)
Ref Sequence ENSEMBL: ENSMUSP00000043818 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043884] [ENSMUST00000132121] [ENSMUST00000134965]
Predicted Effect probably damaging
Transcript: ENSMUST00000043884
AA Change: I483L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043818
Gene: ENSMUSG00000036295
AA Change: I483L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
LRRNT 28 73 9.17e-4 SMART
LRR 115 138 2.63e0 SMART
LRR_TYP 139 162 1.5e-4 SMART
LRR 163 186 7.55e-1 SMART
LRR 187 210 1.76e1 SMART
LRR 211 234 1.62e1 SMART
LRR 235 258 5.11e0 SMART
LRR 260 282 3.18e1 SMART
LRR 333 356 4.44e0 SMART
LRRCT 368 420 3.7e-5 SMART
IGc2 435 503 5.04e-9 SMART
FN3 521 602 3.49e0 SMART
transmembrane domain 626 648 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132121
SMART Domains Protein: ENSMUSP00000118779
Gene: ENSMUSG00000056899

DomainStartEndE-ValueType
Pfam:Peptidase_S24 38 115 7.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134965
SMART Domains Protein: ENSMUSP00000116441
Gene: ENSMUSG00000056899

DomainStartEndE-ValueType
Pfam:Peptidase_S24 38 114 6.4e-11 PFAM
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 99% (69/70)
MGI Phenotype PHENOTYPE: Homozygous null mutant mice exhibited increased mean percent body fat and male homozygous mutant mice exhibited enhanced glucose tolerance when compared with controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,931,196 Y377H probably damaging Het
1810041L15Rik A T 15: 84,406,685 Y120* probably null Het
Aanat G T 11: 116,596,871 G132V probably damaging Het
Abcb11 T A 2: 69,329,376 probably benign Het
Adam26b T A 8: 43,520,714 D417V probably damaging Het
Ank1 T C 8: 23,123,897 S1482P probably benign Het
Armc2 C T 10: 41,922,227 V768M probably damaging Het
Ascc3 C T 10: 50,720,718 probably benign Het
Birc6 T A 17: 74,618,429 probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdh12 A T 15: 21,578,554 probably benign Het
Chd1 A G 17: 17,374,651 D16G probably damaging Het
Clstn2 A G 9: 97,582,562 I180T probably damaging Het
Cxcr6 A G 9: 123,810,485 I184V probably benign Het
Dagla G A 19: 10,248,467 P778S possibly damaging Het
Ddx19b T C 8: 111,020,981 K107R probably benign Het
Dpyd G A 3: 119,412,278 probably null Het
Elf1 T C 14: 79,567,210 V105A possibly damaging Het
Fam13a T G 6: 58,987,186 K87T probably benign Het
Fap C A 2: 62,533,010 S359I probably damaging Het
Fbxo39 T C 11: 72,317,215 I131T possibly damaging Het
Fmn1 T G 2: 113,582,118 S996A probably damaging Het
Gm5866 T C 5: 52,582,746 noncoding transcript Het
Hmcn2 C T 2: 31,360,896 T790M probably damaging Het
Irf2bp2 T C 8: 126,591,811 K339E probably damaging Het
Kat6b A G 14: 21,517,098 D75G probably damaging Het
Kcnab3 A G 11: 69,328,563 T127A probably damaging Het
Kdm5b G T 1: 134,613,345 C725F probably damaging Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Man2c1 C A 9: 57,140,377 probably benign Het
Med23 G T 10: 24,902,201 G810C probably damaging Het
Nhlrc4 T A 17: 25,943,393 K127* probably null Het
Numb T C 12: 83,799,576 D344G probably damaging Het
Nup210l T G 3: 90,119,894 Y194* probably null Het
Ogg1 T C 6: 113,333,843 V317A possibly damaging Het
Olfr822 A G 10: 130,075,274 Y288C probably damaging Het
Olfr97 T A 17: 37,231,465 I302F possibly damaging Het
Pclo A T 5: 14,539,408 probably null Het
Pnpt1 T C 11: 29,138,174 M195T probably benign Het
Polr3c T A 3: 96,725,854 T43S probably damaging Het
Ptprs T C 17: 56,428,978 T152A possibly damaging Het
Rasl10b A T 11: 83,418,523 T134S probably benign Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf39 T C 17: 36,947,229 W96R probably damaging Het
Ros1 G T 10: 52,128,991 A949E probably damaging Het
Rwdd2a A C 9: 86,574,161 N130T possibly damaging Het
Scn9a T C 2: 66,483,648 N1909D probably benign Het
Ska3 C T 14: 57,810,077 V334I probably benign Het
Srebf2 A G 15: 82,182,108 K579R probably benign Het
Sun1 A G 5: 139,238,820 probably benign Het
Tc2n T A 12: 101,694,574 Q133L possibly damaging Het
Tecta T C 9: 42,330,996 T2094A probably damaging Het
Tex2 T C 11: 106,546,894 D650G unknown Het
Trio A G 15: 27,748,091 S2492P probably damaging Het
Ttn T C 2: 76,771,367 T16872A probably benign Het
Ugcg T C 4: 59,189,690 F16S probably benign Het
Usp16 T C 16: 87,458,683 M1T probably null Het
Vmn1r60 C A 7: 5,544,711 C130F possibly damaging Het
Vmn2r101 A G 17: 19,589,657 D235G probably benign Het
Vpreb3 A T 10: 75,939,966 V26E probably benign Het
Vps39 C T 2: 120,342,016 V179I possibly damaging Het
Xrn2 T C 2: 147,061,287 V765A probably benign Het
Zfp251 A G 15: 76,853,636 I414T possibly damaging Het
Zfp426 A T 9: 20,473,117 probably null Het
Zfp61 T C 7: 24,295,981 M1V probably null Het
Other mutations in Lrrn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Lrrn3 APN 12 41452192 intron probably benign
IGL02825:Lrrn3 APN 12 41452593 missense probably damaging 1.00
IGL02927:Lrrn3 APN 12 41453344 missense probably damaging 1.00
IGL02970:Lrrn3 APN 12 41452360 missense probably benign
IGL02995:Lrrn3 APN 12 41452217 missense probably damaging 1.00
IGL02999:Lrrn3 APN 12 41452751 missense probably benign 0.01
IGL03182:Lrrn3 APN 12 41454021 missense probably damaging 1.00
IGL03280:Lrrn3 APN 12 41454147 missense probably damaging 0.97
PIT4469001:Lrrn3 UTSW 12 41453018 missense probably benign 0.03
R0167:Lrrn3 UTSW 12 41454015 missense probably damaging 1.00
R0414:Lrrn3 UTSW 12 41453940 missense probably damaging 1.00
R0787:Lrrn3 UTSW 12 41454231 missense probably damaging 1.00
R0894:Lrrn3 UTSW 12 41454034 missense probably damaging 1.00
R1433:Lrrn3 UTSW 12 41452584 missense possibly damaging 0.74
R1610:Lrrn3 UTSW 12 41452993 missense possibly damaging 0.89
R1834:Lrrn3 UTSW 12 41453518 missense probably damaging 1.00
R2068:Lrrn3 UTSW 12 41452996 missense probably damaging 1.00
R2871:Lrrn3 UTSW 12 41452723 missense probably benign 0.00
R2871:Lrrn3 UTSW 12 41452723 missense probably benign 0.00
R4408:Lrrn3 UTSW 12 41454042 missense probably benign 0.04
R4410:Lrrn3 UTSW 12 41452584 missense possibly damaging 0.74
R4684:Lrrn3 UTSW 12 41454244 missense possibly damaging 0.75
R4770:Lrrn3 UTSW 12 41452443 missense probably benign 0.08
R4927:Lrrn3 UTSW 12 41453125 missense probably damaging 1.00
R5037:Lrrn3 UTSW 12 41453595 missense probably damaging 1.00
R5482:Lrrn3 UTSW 12 41452387 missense probably benign 0.01
R5482:Lrrn3 UTSW 12 41452388 missense probably damaging 0.96
R5667:Lrrn3 UTSW 12 41452298 missense possibly damaging 0.77
R6022:Lrrn3 UTSW 12 41453430 missense probably damaging 0.96
R6087:Lrrn3 UTSW 12 41453535 missense possibly damaging 0.84
R6129:Lrrn3 UTSW 12 41453788 nonsense probably null
R6309:Lrrn3 UTSW 12 41453206 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACACCAGAACAGAATTGGC -3'
(R):5'- TGTTCGGCAAGTGCATTTCAG -3'

Sequencing Primer
(F):5'- GAACAGAATTGGCCCTGATATCTC -3'
(R):5'- CAGGGATATGATGGAAATTTGCCTCC -3'
Posted On2015-03-25